View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2395_low_4 (Length: 210)
Name: NF2395_low_4
Description: NF2395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2395_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Complemental strand, 51899055 - 51898867
Alignment:
| Q |
13 |
catcaacagcaggaagaactccggttgagtttgatcgaagaggcggtctagggcaatccaaactccgacgaattcttcgactcatgagaattatagggtg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51899055 |
catcaacagcaggaagaactccggttgagtttgatcgaagaggcggtctagggcaatccaaactccgacgaattcttcgactcatgagaatgatagggtg |
51898956 |
T |
 |
| Q |
113 |
ttctgttttattcaaaacagtggatgatgatgatctgaactctttacagaaactgatatggcgattgagtgcttcttcaatggtgatga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51898955 |
ttctgttttattcaaaacagtggatgatgatgatctgaactctttacagaaactgatatggcgattgagtgcttcttcaatggtgatga |
51898867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 138 - 199
Target Start/End: Complemental strand, 51887372 - 51887311
Alignment:
| Q |
138 |
gatgatgatctgaactctttacagaaactgatatggcgattgagtgcttcttcaatggtgat |
199 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||| || ||||| | ||||||||||||||||| |
|
|
| T |
51887372 |
gatgatgatctaaactctttatagaaattgatgtgtcgattcaaagcttcttcaatggtgat |
51887311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University