View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2396_high_13 (Length: 283)
Name: NF2396_high_13
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2396_high_13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 171 - 283
Target Start/End: Original strand, 10930826 - 10930938
Alignment:
| Q |
171 |
ttttccaagtatttgatattggatcaaagttgtggaattgaattgagtgtgaatgatgtgatttgggtggtgagagaattgcatagagagaaaagaaagg |
270 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10930826 |
ttttccaagtgttcgatattggatcaaagttgtggaattgaattgagtgtgaatgatgtgatttggggggtgagagaattgcatagagagaaaagaaagg |
10930925 |
T |
|
| Q |
271 |
tggaaaagaaggt |
283 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10930926 |
tggaaaagaaggt |
10930938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 96
Target Start/End: Original strand, 10930671 - 10930754
Alignment:
| Q |
13 |
caaaggatgggagagtgctggggtgagattatgagtggtggcggcaatgaggatgagattatcggaaacggagatagattggac |
96 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10930671 |
caaaggatgggatagtgctggggtgagattatgagtggtggcggcgaggaggatgagattatcggagacggagatagattggac |
10930754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University