View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2396_high_14 (Length: 279)

Name: NF2396_high_14
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2396_high_14
NF2396_high_14
[»] chr5 (1 HSPs)
chr5 (166-265)||(20640883-20640982)
[»] chr6 (1 HSPs)
chr6 (20-232)||(33157896-33158108)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 166 - 265
Target Start/End: Original strand, 20640883 - 20640982
Alignment:
166 gagacaaattcgccagttgtagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatggagagtttatgacattgagactcatgaattctt 265  Q
    |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
20640883 gagaaaaattcgccagtcgtagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatggagagtttatgacattgagactcttgaattctt 20640982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 33157896 - 33158108
Alignment:
20 gacagcaggatacttgattaaccgcactccaagctccattttaaaaggaaagaccccatatgaagtgttgcatggaaaaccaccctcatatgctcattta 119  Q
    ||||||||| ||||||||||| || ||||||||||| || || || || || || || || ||||| ||||| |||||||||||||| ||  ||||  ||    
33157896 gacagcagggtacttgattaatcgtactccaagctcaatattgaatgggaaaactccgtacgaagtattgcacggaaaaccaccctcttacactcaccta 33157995  T
120 tgtatttttggatctttgtgttttgcacgcaaccaaaatacgaacggagacaaattcgccagttgtagtcgtcgatgtgtcttcgtgggatatccttatg 219  Q
     | || ||||| || || |||| |||  ||||||||  |||||| |||||||||||  | ||| | ||||||   ||||||||||| |||||||||||||    
33157996 cgcatatttggttcattatgttatgcgtgcaaccaaggtacgaaaggagacaaattttcaagtcgcagtcgtaagtgtgtcttcgtaggatatccttatg 33158095  T
220 gacaaaagggatg 232  Q
    | ||||| |||||    
33158096 gccaaaaaggatg 33158108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University