View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2396_high_4 (Length: 441)

Name: NF2396_high_4
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2396_high_4
NF2396_high_4
[»] scaffold0084 (3 HSPs)
scaffold0084 (141-258)||(36259-36376)
scaffold0084 (324-431)||(38607-38714)
scaffold0084 (20-110)||(35998-36089)
[»] chr6 (4 HSPs)
chr6 (141-255)||(27510075-27510189)
chr6 (141-255)||(27518018-27518132)
chr6 (31-106)||(27510342-27510417)
chr6 (31-106)||(27518285-27518360)
[»] scaffold1271 (1 HSPs)
scaffold1271 (318-431)||(1430-1542)
[»] chr4 (1 HSPs)
chr4 (27-106)||(16361093-16361174)
[»] chr1 (1 HSPs)
chr1 (20-54)||(5623274-5623308)


Alignment Details
Target: scaffold0084 (Bit Score: 94; Significance: 1e-45; HSPs: 3)
Name: scaffold0084
Description:

Target: scaffold0084; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 141 - 258
Target Start/End: Original strand, 36259 - 36376
Alignment:
141 cgactcggcttcgacacgtctgtttgcttctgttggtgtatgaatctgattcagtggttccggctatccactgcaactcgttcattacctggtgctgggc 240  Q
    ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||| |||||||||||||||||| |||||    
36259 cgactcggcttcgacgcgtctgtttgcttctgttggtgtatgaatccgattcagtggttccggcgatccgctgcagctcgttcattacctggtgttgggc 36358  T
241 tcgacgtcagttgattgt 258  Q
    ||||||||||||||||||    
36359 tcgacgtcagttgattgt 36376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0084; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 324 - 431
Target Start/End: Original strand, 38607 - 38714
Alignment:
324 gttttgtgggtacaactttgattggtgttaatgttgttgtgcgaggccggtggttggatttgatgaatgtgttcgatgtgcgattctatgtgcttgtacg 423  Q
    |||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||    
38607 gttttgtgaggacgactttaattggtgttaatgttgttgtgcgaggccggtggttggatttgatgaatgtgttggatgtgcgattctatatgtttgtacg 38706  T
424 gtcctatg 431  Q
    ||||||||    
38707 gtcctatg 38714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0084; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 35998 - 36089
Alignment:
20 cggcgaaccatcgcggctgcgccaccgcgccggagagaaaagggtctcccttttatggatttctaacct-aaatttcacgctcttctcgatt 110  Q
    |||||| |||||||| ||||||| |||||||||||| ||||| ||||||| ||||||||||| |||||| ||||||||| ||||||||||||    
35998 cggcgagccatcgcgactgcgccgccgcgccggagacaaaagagtctcccctttatggatttttaacctaaaatttcaccctcttctcgatt 36089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 79; Significance: 9e-37; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 141 - 255
Target Start/End: Complemental strand, 27510189 - 27510075
Alignment:
141 cgactcggcttcgacacgtctgtttgcttctgttggtgtatgaatctgattcagtggttccggctatccactgcaactcgttcattacctggtgctgggc 240  Q
    |||||||| | ||||||||| ||||||||||||||||||||||| | ||||||||||||||||| |||| ||||| ||||||| ||||||||||||||||    
27510189 cgactcggttccgacacgtccgtttgcttctgttggtgtatgaacccgattcagtggttccggcgatccgctgcagctcgttcgttacctggtgctgggc 27510090  T
241 tcgacgtcagttgat 255  Q
    |||||||||||||||    
27510089 tcgacgtcagttgat 27510075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 141 - 255
Target Start/End: Complemental strand, 27518132 - 27518018
Alignment:
141 cgactcggcttcgacacgtctgtttgcttctgttggtgtatgaatctgattcagtggttccggctatccactgcaactcgttcattacctggtgctgggc 240  Q
    |||||||| | ||||||||| ||||||||||||||||||||||| | ||||||||||||||||| |||| ||||| ||||||| ||||||||||||||||    
27518132 cgactcggttccgacacgtccgtttgcttctgttggtgtatgaacccgattcagtggttccggcgatccgctgcagctcgttcgttacctggtgctgggc 27518033  T
241 tcgacgtcagttgat 255  Q
    |||||||||||||||    
27518032 tcgacgtcagttgat 27518018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 31 - 106
Target Start/End: Complemental strand, 27510417 - 27510342
Alignment:
31 cgcggctgcgccaccgcgccggagagaaaagggtctcccttttatggatttctaacctaaatttcacgctcttctc 106  Q
    |||||||||||| |||||| ||||| ||||||||||   |||| ||||||||||||||||||||||| ||||||||    
27510417 cgcggctgcgccgccgcgctggagacaaaagggtcttttttttttggatttctaacctaaatttcaccctcttctc 27510342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 31 - 106
Target Start/End: Complemental strand, 27518360 - 27518285
Alignment:
31 cgcggctgcgccaccgcgccggagagaaaagggtctcccttttatggatttctaacctaaatttcacgctcttctc 106  Q
    |||||||||||| |||||| ||||| ||||||||||   |||| ||||||||||||||||||||||| ||||||||    
27518360 cgcggctgcgccgccgcgctggagacaaaagggtcttttttttttggatttctaacctaaatttcaccctcttctc 27518285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1271 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold1271
Description:

Target: scaffold1271; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 318 - 431
Target Start/End: Original strand, 1430 - 1542
Alignment:
318 tgttgggttttgtgggtacaactttgattggtgttaatgttgttgtgcgaggccggtggttggatttgatgaatgtgttcgatgtgcgattctatgtgct 417  Q
    ||||||||| | || ||||  |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||| |||||||| |    
1430 tgttgggttctatgtgtacggctttgatttgtgttaatgctgttgtgcgaggccggtggttggatttgatgaatgtgttgtatgtgcgagtctatgtg-t 1528  T
418 tgtacggtcctatg 431  Q
    |||||||| |||||    
1529 tgtacggtgctatg 1542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 27 - 106
Target Start/End: Complemental strand, 16361174 - 16361093
Alignment:
27 ccatcgcggctgcgccaccgcgccggagagaaaagggtctcc--cttttatggatttctaacctaaatttcacgctcttctc 106  Q
    |||||||||||||||| |||||||||||| ||||||||||||   |||| |||||||||| |||||||||||| ||||||||    
16361174 ccatcgcggctgcgccgccgcgccggagacaaaagggtctcctttttttttggatttctaccctaaatttcaccctcttctc 16361093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 5623274 - 5623308
Alignment:
20 cggcgaaccatcgcggctgcgccaccgcgccggag 54  Q
    ||||||||||||||||||||||| |||||||||||    
5623274 cggcgaaccatcgcggctgcgccgccgcgccggag 5623308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University