View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2396_low_14 (Length: 292)
Name: NF2396_low_14
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2396_low_14 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 14 - 282
Target Start/End: Complemental strand, 53277991 - 53277723
Alignment:
| Q |
14 |
caaaaccttcggcggtaccggtttgagtgccaaagaaaacggtaacttttttggtaccgtcatcgatttcaagttcaggaagtttctcgataacgcgttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53277991 |
caaaaccttcggcggtaccggtttgagtgccaaagaaaacggtaacttttttggtaccgtcatcgatttcaagttcaggaagtttctcgataacgcgttt |
53277892 |
T |
|
| Q |
114 |
aggaacttcaattggttttggtttttgagaattggatctacgccaaattaaaacgacgacacaaccgatgagaacagcgattgaagttgttaagatcata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53277891 |
aggaacttcaattggttttggtttttgagaattggatctacgccaaattaaaacgacgacgcaaccgatgagaacagctattgaagttgttaagatcata |
53277792 |
T |
|
| Q |
214 |
acgaattcgcggttctcaagtatgagtgaagctggaacggttccattggatggatcgattttgcctttg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53277791 |
acgaattcgcggttctcaagtatgagtgaagctggaacggttccattggatggatcgattttgcctttg |
53277723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 109 - 180
Target Start/End: Original strand, 93781 - 93852
Alignment:
| Q |
109 |
cgtttaggaacttcaattggttttggtttttgagaattggatctacgccaaattaaaacgacgacacaaccg |
180 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| ||||| ||| | ||| | |||| |||||||||| |
|
|
| T |
93781 |
cgtttagcaacttcaattggttttgagttttgagaattagatctgcgcaatatttatacgatgacacaaccg |
93852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 7103467 - 7103511
Alignment:
| Q |
108 |
gcgtttaggaacttcaattggttttggtttttgagaattggatct |
152 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
7103467 |
gcgtttagcaacttcaattggttttgagttttgagaattagatct |
7103511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 7631183 - 7631139
Alignment:
| Q |
108 |
gcgtttaggaacttcaattggttttggtttttgagaattggatct |
152 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
7631183 |
gcgtttagcaacttcaattggttttgagttttgagaattagatct |
7631139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 9658248 - 9658292
Alignment:
| Q |
108 |
gcgtttaggaacttcaattggttttggtttttgagaattggatct |
152 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
9658248 |
gcgtttagcaacttcaattggttttgagttttgagaattagatct |
9658292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University