View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2396_low_17 (Length: 279)
Name: NF2396_low_17
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2396_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 166 - 265
Target Start/End: Original strand, 20640883 - 20640982
Alignment:
| Q |
166 |
gagacaaattcgccagttgtagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatggagagtttatgacattgagactcatgaattctt |
265 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20640883 |
gagaaaaattcgccagtcgtagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatggagagtttatgacattgagactcttgaattctt |
20640982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 33157896 - 33158108
Alignment:
| Q |
20 |
gacagcaggatacttgattaaccgcactccaagctccattttaaaaggaaagaccccatatgaagtgttgcatggaaaaccaccctcatatgctcattta |
119 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||| || || || || || || || || ||||| ||||| |||||||||||||| || |||| || |
|
|
| T |
33157896 |
gacagcagggtacttgattaatcgtactccaagctcaatattgaatgggaaaactccgtacgaagtattgcacggaaaaccaccctcttacactcaccta |
33157995 |
T |
 |
| Q |
120 |
tgtatttttggatctttgtgttttgcacgcaaccaaaatacgaacggagacaaattcgccagttgtagtcgtcgatgtgtcttcgtgggatatccttatg |
219 |
Q |
| |
|
| || ||||| || || |||| ||| |||||||| |||||| ||||||||||| | ||| | |||||| ||||||||||| ||||||||||||| |
|
|
| T |
33157996 |
cgcatatttggttcattatgttatgcgtgcaaccaaggtacgaaaggagacaaattttcaagtcgcagtcgtaagtgtgtcttcgtaggatatccttatg |
33158095 |
T |
 |
| Q |
220 |
gacaaaagggatg |
232 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
33158096 |
gccaaaaaggatg |
33158108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University