View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2396_low_22 (Length: 251)
Name: NF2396_low_22
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2396_low_22 |
 |  |
|
| [»] chr8 (150 HSPs) |
 |  |
|
| [»] chr6 (119 HSPs) |
 |  |
|
| [»] chr1 (180 HSPs) |
 |  |
|
| [»] chr7 (154 HSPs) |
 |  |
|
| [»] chr5 (148 HSPs) |
 |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
| [»] chr4 (176 HSPs) |
 |  |
|
| [»] chr3 (178 HSPs) |
 |  |
|
| [»] chr2 (147 HSPs) |
 |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 150)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 7325901 - 7326132
Alignment:
| Q |
17 |
gaaaattatacaaatgtgacacagaattctgtgacagcagagacatgctggaaatctaataaataaattactaacaaatttaagatatatggtttacgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7325901 |
gaaaattatacaaatgtgacacagaattctgtgacagcagggacatgctgggaatctaataaataaattactaacaaatttaagatatatggtttacatt |
7326000 |
T |
 |
| Q |
117 |
gtttataagcaaaattaatgtttggcaaagtggttgaatataacnnnnnnnnagagcaaatatcataatctccacataaataattataagctaaaatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7326001 |
gtttataagcaaaattaatgtttggcgaagtggttgaatataa---ttgttaagaacaaatatcataatctccacataaataattataggctaaaatatg |
7326097 |
T |
 |
| Q |
217 |
gttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7326098 |
gttttggtccttgcaaatatgcctcgttttggttt |
7326132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 6146515 - 6146562
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6146515 |
aagctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
6146562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 11019865 - 11019811
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11019865 |
taattttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
11019811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 28346766 - 28346712
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28346766 |
taattttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
28346712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2728596 - 2728551
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2728596 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
2728551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4017299 - 4017254
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4017299 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
4017254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4710219 - 4710174
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4710219 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
4710174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7326420 - 7326375
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7326420 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
7326375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8094840 - 8094795
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8094840 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
8094795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11976374 - 11976419
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11976374 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
11976419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 13154879 - 13154932
Alignment:
| Q |
198 |
aattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
13154879 |
aattataggctaaaatatagttttgatccttgcaaatatgcctcgttttggttt |
13154932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24090487 - 24090442
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
24090442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28346395 - 28346440
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28346395 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
28346440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 32726270 - 32726225
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32726270 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
32726225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34963301 - 34963346
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34963301 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
34963346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35097691 - 35097646
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35097691 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
35097646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37536087 - 37536132
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37536087 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
37536132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 8298985 - 8298929
Alignment:
| Q |
195 |
aataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
8298985 |
aataattaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
8298929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 4016904 - 4016951
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4016904 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4016951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1525810 - 1525855
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1525810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
1525855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1778565 - 1778610
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1778565 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
1778610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3511907 - 3511952
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
3511907 |
gctaaaatatggttttggtcccttcaaatatgcctcgttttggttt |
3511952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3512265 - 3512220
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3512265 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
3512220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4375693 - 4375738
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4375693 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4375738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4474043 - 4473998
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
4474043 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
4473998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4621353 - 4621308
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
4621353 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggttt |
4621308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5357424 - 5357469
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
5357424 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
5357469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7186003 - 7185958
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
7186003 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
7185958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7420231 - 7420276
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
7420231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
7420276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7420589 - 7420544
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7420589 |
gctaaaatatggttttggtcactgcaaatatgcctcgttttggttt |
7420544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8298588 - 8298633
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
8298588 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
8298633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9175013 - 9175058
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
9175013 |
gctaaaatatgattttggtccttgcaaatatgtctcgttttggttt |
9175058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9496342 - 9496387
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9496342 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
9496387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9496722 - 9496677
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9496722 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
9496677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10337120 - 10337165
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10337120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
10337165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10337448 - 10337403
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
10337448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttt |
10337403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10540781 - 10540736
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10540781 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
10540736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10776498 - 10776453
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10776498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
10776453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10872916 - 10872961
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
10872916 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
10872961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10873279 - 10873234
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10873279 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
10873234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11019521 - 11019566
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
11019521 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
11019566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13232561 - 13232516
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
13232561 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
13232516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13779531 - 13779486
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttt |
13779486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14239079 - 14239034
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
14239079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
14239034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14489072 - 14489027
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
14489072 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
14489027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14495070 - 14495115
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
14495070 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
14495115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16789368 - 16789323
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16789368 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
16789323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19494412 - 19494367
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19494412 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
19494367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20277693 - 20277738
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
20277693 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttt |
20277738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20278056 - 20278011
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
20278056 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggttt |
20278011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20984147 - 20984192
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
20984147 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttt |
20984192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21064320 - 21064365
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21064320 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttt |
21064365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 21064683 - 21064638
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
21064683 |
gctaaaatatggttttggtccctgcagatatgcctcgttttggttt |
21064638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22917565 - 22917610
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22917565 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
22917610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25600231 - 25600276
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25600231 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
25600276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 27117975 - 27117930
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
27117975 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
27117930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 27341590 - 27341545
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
27341590 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27341545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32418319 - 32418364
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
32418319 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
32418364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32725908 - 32725953
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
32725908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
32725953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34963663 - 34963618
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
34963663 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
34963618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35097329 - 35097374
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35097329 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35097374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35346630 - 35346675
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35346630 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35346675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35346997 - 35346952
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35346997 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35346952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 37536418 - 37536373
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37536418 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
37536373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42132865 - 42132910
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42132865 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
42132910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 42133153 - 42133108
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42133153 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
42133108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43477164 - 43477209
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43477164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
43477209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 1526177 - 1526126
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
1526177 |
ttataggctaaaatatggttttagtccctgcaaatatggctcgttttggttt |
1526126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 1685117 - 1685160
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
1685160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 6146950 - 6146903
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
6146950 |
aagctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
6146903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 9175368 - 9175325
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttt |
9175325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 11976733 - 11976690
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
11976690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 13232201 - 13232244
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13232244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 28497616 - 28497573
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttt |
28497573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 36044793 - 36044746
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
36044793 |
aagctaaaatatggttttggtccctgcaaatgtgtctcgttttggttt |
36044746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 18549197 - 18549247
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
18549197 |
tataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
18549247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 29158350 - 29158400
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
29158350 |
tataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
29158400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2728233 - 2728278
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
2728233 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttt |
2728278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3680800 - 3680755
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3680800 |
gctaaaatatgattttgatccctgcaaatatgcctcgttttggttt |
3680755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4473705 - 4473750
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
4473705 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttt |
4473750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5357762 - 5357717
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttt |
5357717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6469281 - 6469326
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
6469281 |
gctaaaatatggctttcgtccctgcaaatatgcctcgttttggttt |
6469326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7272421 - 7272466
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
7272421 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
7272466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7272750 - 7272705
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
7272750 |
gctaaaatatggttttagcccctgcaaatatgcctcgttttggttt |
7272705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10540450 - 10540495
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
10540450 |
gctaaaatattgttttggtctctgcaaatatgcctcgttttggttt |
10540495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 10755527 - 10755486
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
10755527 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
10755486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14238752 - 14238797
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
14238752 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
14238797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 14496805 - 14496862
Alignment:
| Q |
195 |
aataattataag-ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| ||||||||||||||| || | ||||||||||| |||||||||||| |
|
|
| T |
14496805 |
aataattataaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttt |
14496862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16643662 - 16643707
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
16643662 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
16643707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16644043 - 16643998
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
16644043 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttt |
16643998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16789076 - 16789121
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
16789076 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
16789121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 17073808 - 17073853
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
17073808 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
17073853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 17574462 - 17574417
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
17574462 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
17574417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19494120 - 19494165
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
19494120 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
19494165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20984509 - 20984464
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
20984509 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttt |
20984464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21125720 - 21125765
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
21125720 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
21125765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 210 - 251
Target Start/End: Original strand, 24814710 - 24814751
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttt |
24814751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24955009 - 24954964
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
24955009 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttt |
24954964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25131112 - 25131157
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
25131112 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
25131157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25131446 - 25131401
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
25131446 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttt |
25131401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28497256 - 28497301
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
28497256 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttagttt |
28497301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29488109 - 29488064
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
29488109 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
29488064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30969399 - 30969444
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttt |
30969444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33526411 - 33526366
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
33526411 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
33526366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33636323 - 33636368
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
33636323 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
33636368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35345616 - 35345571
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
35345616 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttt |
35345571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38930663 - 38930618
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
38930663 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
38930618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40066498 - 40066543
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
40066498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
40066543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40066819 - 40066774
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
40066819 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttt |
40066774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40844157 - 40844202
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
40844157 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
40844202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 42430119 - 42430074
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
42430119 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
42430074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 44997932 - 44997973
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
44997932 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttg |
44997973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 10776150 - 10776194
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
10776194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 13779151 - 13779195
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
13779195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 18549571 - 18549527
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttt |
18549527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 246
Target Start/End: Original strand, 25702513 - 25702553
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
25702513 |
gctaaaatatggttttggtccctgtaaatatgcctcgtttt |
25702553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 40493156 - 40493112
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtt |
250 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40493156 |
gctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 2811778 - 2811735
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttt |
2811735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 29991918 - 29991961
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttt |
29991961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 206 - 241
Target Start/End: Complemental strand, 30969716 - 30969681
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctc |
241 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30969716 |
gctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 8094475 - 8094525
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
8094475 |
tataggctaaaatatggttttagtctctgcaaatatgtctcgttttggttt |
8094525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14495389 - 14495344
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttt |
14495344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 19962991 - 19963041
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
19962991 |
tataggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttt |
19963041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 35115647 - 35115593
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||| |||||||||||||||| |||| | ||||||| |||||||||||||| |
|
|
| T |
35115647 |
taataataggctaaaatatggttttagtccctacaaatatacctcgttttggttt |
35115593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 1162910 - 1162951
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
1162910 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttg |
1162951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1163273 - 1163228
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| |||||| |||| |
|
|
| T |
1163273 |
gctaaaatatggttttagtccatgcaaatatgccccgttttagttt |
1163228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1408006 - 1408051
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
1408006 |
gctaaaatatggttttagtccatgcaaatatgtctcgttttagttt |
1408051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1408352 - 1408307
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||| |||| |
|
|
| T |
1408352 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttt |
1408307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 1778637 - 1778670
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
1778637 |
ttttggtccttgcaaatatgcctcattttggttt |
1778670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Original strand, 3680532 - 3680573
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttt |
3680573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9832216 - 9832261
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
9832216 |
gctaaattatggttttggtccttgcaaatatgttttgttttggttt |
9832261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13155250 - 13155205
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
13155250 |
gctaaaatatggtttttgttcctgcaaatatgtctcgttttggttt |
13155205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14488717 - 14488762
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| || ||||||||||||||||||||| |
|
|
| T |
14488717 |
gctaaaatatagttttagtccctgaaaatatgcctcgttttggttt |
14488762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15719657 - 15719702
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
15719657 |
gctaaaatatggttttagtccctgcaaatatatctcgttttggttt |
15719702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 22650465 - 22650506
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
22650465 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
22650506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23939548 - 23939593
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
23939548 |
gctaaaatatggttttggtcactgcaaatatgtctcgttttagttt |
23939593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24187570 - 24187615
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
24187570 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttt |
24187615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24187896 - 24187851
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| ||||||||||||| |
|
|
| T |
24187896 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttt |
24187851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24815067 - 24815022
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| || |||||||||| ||| ||||||||| |
|
|
| T |
24815067 |
gctaaaatatggttttggcccctgcaaatatgtctcattttggttt |
24815022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 27117754 - 27117795
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
27117754 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttg |
27117795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28323850 - 28323895
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| | |||| ||||||||||| |||||||||||| |
|
|
| T |
28323850 |
gctaaaatatggttgtagtccctgcaaatatgcttcgttttggttt |
28323895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28324180 - 28324135
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| || |||||||||| |
|
|
| T |
28324180 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttt |
28324135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 247
Target Start/End: Complemental strand, 29992295 - 29992258
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
29992295 |
aaatatggttttgttccctgcaaatatgcctcgttttg |
29992258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30337216 - 30337171
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
30337216 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33526053 - 33526098
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||| |||||||| |
|
|
| T |
33526053 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttt |
33526098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35143843 - 35143798
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
35143843 |
gctaaaatatggttttaatccgtgtaaatatgcctcgttttggttt |
35143798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38930303 - 38930348
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||||||| |
|
|
| T |
38930303 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttt |
38930348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40492961 - 40493006
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
40492961 |
gctaaaatatggttttagtacctgcaaatatgtctcgttttggttt |
40493006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 25702808 - 25702768
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
25702808 |
gctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 43727431 - 43727388
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcct-gcaaatatgtctcgttttggttt |
43727388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 119)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 22543347 - 22543400
Alignment:
| Q |
198 |
aattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22543347 |
aattataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
22543400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 14428648 - 14428696
Alignment:
| Q |
203 |
taagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14428648 |
taagctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
14428696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 25137361 - 25137311
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25137361 |
tataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
25137311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1007508 - 1007463
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1007508 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
1007463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3414388 - 3414433
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3414388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
3414433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3969008 - 3968963
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3969008 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
3968963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12299139 - 12299094
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12299139 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
12299094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14656259 - 14656214
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14656259 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttt |
14656214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15962028 - 15962073
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15962028 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
15962073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19321130 - 19321085
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19321130 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
19321085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20467717 - 20467672
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20467717 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
20467672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 21994402 - 21994357
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21994402 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
21994357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23502238 - 23502283
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23502238 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
23502283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 11449168 - 11449124
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtt |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11449168 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggtt |
11449124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13268097 - 13268155
Alignment:
| Q |
192 |
ataaataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
13268097 |
ataaataatta-aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttt |
13268155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 18024014 - 18024057
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttt |
18024057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 30479423 - 30479376
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
30479423 |
aagctaaaatatggttttggttcatgcaaatatgcctcgttttggttt |
30479376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 31166869 - 31166916
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31166869 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
31166916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 6412210 - 6412264
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6412210 |
taattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
6412264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 21147400 - 21147450
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
21147400 |
tataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttt |
21147450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 21995424 - 21995382
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttgg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21995424 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttgg |
21995382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 494406 - 494451
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
494406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
494451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1007125 - 1007170
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1007125 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
1007170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3276353 - 3276308
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3276353 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
3276308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3968646 - 3968691
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3968646 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
3968691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 6412578 - 6412537
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6412578 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttg |
6412537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7156159 - 7156114
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7156159 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
7156114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8170150 - 8170105
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
8170150 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
8170105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10910963 - 10910918
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10910963 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
10910918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12757611 - 12757656
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12757611 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
12757656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15076203 - 15076158
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
15076203 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
15076158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15962388 - 15962343
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
15962388 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
15962343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 17765010 - 17765055
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
17765010 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
17765055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19296406 - 19296361
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19296406 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
19296361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19690394 - 19690439
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
19690394 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
19690439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21385252 - 21385297
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
21385252 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
21385297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 21385583 - 21385538
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
21385583 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
21385538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22543717 - 22543672
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
22543717 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
22543672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24274130 - 24274085
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
24274130 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
24274085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24901240 - 24901285
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24901240 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
24901285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25136995 - 25137040
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25136995 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttt |
25137040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31198616 - 31198661
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
31198616 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttt |
31198661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33131849 - 33131804
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
33131849 |
gctaaaatatggttttagtctttgcaaatatgcctcgttttggttt |
33131804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33801742 - 33801697
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33801742 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
33801697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34582530 - 34582575
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
34582530 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
34582575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 13617531 - 13617575
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttt |
13617575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 14428948 - 14428904
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttt |
14428904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 494753 - 494706
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
494753 |
aagctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
494706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 3356495 - 3356452
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
3356452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 20467354 - 20467397
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttt |
20467397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 26376042 - 26375999
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
26375999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 251
Target Start/End: Original strand, 543365 - 543407
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttt |
543407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 12419704 - 12419754
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
12419704 |
tataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
12419754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 19129332 - 19129382
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||| ||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
19129332 |
tataggctacaatatggctttggtccctgcaaatatgcctcgttttggttt |
19129382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 32885669 - 32885719
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
32885669 |
tataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
32885719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 1890451 - 1890410
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1890451 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
1890410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2615873 - 2615918
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
2615873 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttt |
2615918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2616239 - 2616194
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
2616239 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
2616194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3356143 - 3356188
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
3356143 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
3356188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3414751 - 3414706
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
3414751 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttt |
3414706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6591116 - 6591161
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
6591116 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttt |
6591161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7155798 - 7155843
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7155798 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
7155843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8680776 - 8680821
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
8680776 |
gctaaaatatgtttttagtccctgcaaatatgcctcgttttggttt |
8680821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8681115 - 8681070
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
8681115 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
8681070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12419937 - 12419892
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
12419937 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
12419892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14655380 - 14655425
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
14655380 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
14655425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 15442938 - 15442979
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
15442938 |
gctaaaatatggttttggtccctgcaaatatacctcgttttg |
15442979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 17771912 - 17771957
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
17771912 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
17771957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18024374 - 18024329
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
18024374 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttt |
18024329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19267566 - 19267611
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
19267566 |
gctaaaatatggttttggtccctgtaaatatgcttcgttttggttt |
19267611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21993788 - 21993833
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
21993788 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttt |
21993833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21995065 - 21995110
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
21995065 |
gctaaaatatggttttagtccctgcatatatgcctcgttttggttt |
21995110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22792898 - 22792853
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
22792898 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttt |
22792853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 22822650 - 22822609
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
22822650 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
22822609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 23502539 - 23502494
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
23502539 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
23502494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23770162 - 23770207
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
23770207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24273829 - 24273874
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
24273829 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
24273874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25431853 - 25431808
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
25431853 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
25431808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30928682 - 30928727
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
30928682 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
30928727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30929043 - 30928998
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
30929043 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
30928998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34582891 - 34582846
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
34582891 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttt |
34582846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 2373180 - 2373224
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtt |
250 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
2373180 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggtt |
2373224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 5286949 - 5286905
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
5286905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 19320769 - 19320813
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
19320813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 23770438 - 23770398
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
23770438 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 7324189 - 7324146
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttt |
7324146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 12176640 - 12176597
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttt |
12176597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 12298825 - 12298868
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttt |
12298868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 23628797 - 23628844
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
23628797 |
aagctaaaatatggttttggtccctgcaaatatatttcgttttggttt |
23628844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 34990312 - 34990269
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttt |
34990269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 251
Target Start/End: Complemental strand, 13617804 - 13617770
Alignment:
| Q |
217 |
gttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttt |
13617770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 247
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 30479058 - 30479108
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggtt |
250 |
Q |
| |
|
||||| ||||||||||||||||||||| || ||||||| | |||||||||| |
|
|
| T |
30479058 |
ttataggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 34989961 - 34990003
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
34989961 |
agctaaaatatgcttttagtccctgcaaatatgcctcgttttg |
34990003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 317813 - 317858
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
317813 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
317858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 778041 - 777996
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
778041 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttagttt |
777996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1214995 - 1214950
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
1214995 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttt |
1214950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6468311 - 6468356
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| | |||||||||| |
|
|
| T |
6468311 |
gctaaaatatggttttagtccctgcaaatatgctttgttttggttt |
6468356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 6564872 - 6564839
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
6564872 |
ttttggtccatgcaaatatgcctcgttttggttt |
6564839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 6564942 - 6564898
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6564942 |
gctaaaat-tggttttggtccctgcaaatatgtctcgttttggttt |
6564898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9896636 - 9896591
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
9896636 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttt |
9896591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10910630 - 10910675
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
10910630 |
gctaaaatatggttttggtctctacaaatatgtctcgttttggttt |
10910675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 11129542 - 11129497
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
11129542 |
gctaaaatatgattttactccctgcaaatatgcctcgttttggttt |
11129497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11448538 - 11448583
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| ||||||||||||| |
|
|
| T |
11448538 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttt |
11448583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12612358 - 12612313
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
12612358 |
gctaaaatatggtgttagtccctgcaaatatgcctcgttttagttt |
12612313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 12757864 - 12757831
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
12757864 |
ttttggtccttgcaaatatgcatcgttttggttt |
12757831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 15722611 - 15722652
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15722611 |
gctaaaatatggttttggtctatgcaaatatgtctcgttttg |
15722652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19129519 - 19129474
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| | ||||||||||| |
|
|
| T |
19129519 |
gctaaaatatgattttggtccctgcaaatatgtcacgttttggttt |
19129474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 19320840 - 19320873
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
19320840 |
ttttggtccttgcaaatatgcctcattttggttt |
19320873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22822308 - 22822353
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
22822308 |
gctaaaatatggttttagtctctgcaaatatacctcgttttggttt |
22822353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 24692978 - 24692937
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
24692978 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
24692937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25121495 - 25121450
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
25121495 |
gctaaaatatggttttggtgcctgcaaatatgtttcgttttggttt |
25121450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26375694 - 26375739
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
26375694 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
26375739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 31167199 - 31167158
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
31167199 |
gctaaaatatggttttagtccctgcaaatatggctcgttttg |
31167158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31186590 - 31186545
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||| |||| |
|
|
| T |
31186590 |
gctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttt |
31186545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 33808621 - 33808662
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||| |
|
|
| T |
33808621 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttg |
33808662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 6591440 - 6591396
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttt |
6591396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 17765374 - 17765334
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
17765374 |
gctaaaatatgattttggtccctgcaaatatgtctcgtttt |
17765334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 247
Target Start/End: Complemental strand, 31276346 - 31276298
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||| ||||||||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
31276346 |
attaaaagctaaaataaagttttggtccctgcaaatatgtctcgttttg |
31276298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 180)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15211857 - 15211812
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15211857 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 32420097 - 32420144
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32420097 |
aagctaaaatatggttttggtccttgcaaatatgtctcgttttggttt |
32420144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 251
Target Start/End: Original strand, 3753210 - 3753259
Alignment:
| Q |
202 |
ataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3753210 |
ataagctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
3753259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 22919677 - 22919730
Alignment:
| Q |
198 |
aattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22919677 |
aattataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
22919730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24507842 - 24507797
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24507842 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
24507797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24653803 - 24653848
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24653803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
24653848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33045689 - 33045644
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33045689 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
33045644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38151211 - 38151166
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38151211 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
38151166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38164294 - 38164249
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38164294 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
38164249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 44157696 - 44157741
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
44157741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 47819233 - 47819278
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47819233 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
47819278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 47819595 - 47819550
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47819595 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
47819550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 49073692 - 49073737
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49073692 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttt |
49073737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 26207280 - 26207324
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttt |
26207324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 48730615 - 48730571
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttt |
48730571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 3247559 - 3247516
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
3247516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 26324580 - 26324631
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
26324580 |
ttataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
26324631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 38163934 - 38163977
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
38163977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 44641077 - 44641124
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44641077 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
44641124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 13770485 - 13770535
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
13770485 |
tataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
13770535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 209 - 251
Target Start/End: Complemental strand, 24649656 - 24649614
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttt |
24649614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 35056898 - 35056848
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
35056898 |
tataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
35056848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 39747843 - 39747789
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
39747843 |
taataataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
39747789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 990378 - 990333
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
990378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
990333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1810928 - 1810973
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1810928 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
1810973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3247199 - 3247244
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3247199 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
3247244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7001896 - 7001851
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7001896 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
7001851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8140435 - 8140480
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
8140435 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
8140480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8140798 - 8140753
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8140798 |
gctaaaatatggttttggtacctgcaaatatgcctcgttttggttt |
8140753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10631165 - 10631210
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10631165 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
10631210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10631527 - 10631482
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10631527 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttt |
10631482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10887597 - 10887552
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10887597 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
10887552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11822005 - 11822050
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
11822005 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
11822050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12322969 - 12322924
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12322969 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
12322924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12360967 - 12360922
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12360967 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
12360922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15058419 - 15058464
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttt |
15058464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15516583 - 15516628
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
15516583 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggttt |
15516628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15526361 - 15526316
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
15526361 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
15526316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16026937 - 16026892
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
16026937 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
16026892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16060884 - 16060839
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
16060884 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
16060839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 18079399 - 18079444
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18079399 |
gctaaaatacggttttggtccttgcaaatatgcctcattttggttt |
18079444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18302386 - 18302341
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18302386 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18302341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 18473273 - 18473318
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18473273 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18473318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18473594 - 18473549
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18473594 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18473549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19720713 - 19720758
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
19720713 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
19720758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24507480 - 24507525
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
24507480 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
24507525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24649351 - 24649396
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
24649351 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
24649396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24654166 - 24654121
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24654166 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
24654121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24977779 - 24977824
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24977779 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
24977824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24978121 - 24978076
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24978121 |
gctaaaatatagttttggtcctggcaaatatgcctcgttttggttt |
24978076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26061957 - 26062002
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
26061957 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
26062002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26442898 - 26442853
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
26442898 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttt |
26442853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29072498 - 29072543
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29072498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
29072543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30322930 - 30322975
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
30322930 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
30322975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30323292 - 30323247
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30323292 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
30323247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 32729048 - 32729003
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
32729048 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
32729003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 33000306 - 33000347
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33000306 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttg |
33000347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33000668 - 33000623
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
33000668 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
33000623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33067349 - 33067394
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
33067349 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttt |
33067394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33234547 - 33234592
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
33234547 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
33234592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33379889 - 33379934
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33379889 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
33379934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35005743 - 35005698
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35005743 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
35005698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35056531 - 35056576
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35056531 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35056576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35307716 - 35307761
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35307716 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
35307761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35308110 - 35308065
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35308110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
35308065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37545629 - 37545674
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37545629 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttt |
37545674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38136980 - 38136935
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
38136980 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
38136935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40718111 - 40718156
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
40718111 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
40718156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41358370 - 41358415
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
41358370 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
41358415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45368491 - 45368536
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
45368491 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
45368536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45380273 - 45380318
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45380273 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
45380318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45380635 - 45380590
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
45380635 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
45380590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45638581 - 45638626
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45638581 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
45638626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45638893 - 45638848
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45638893 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
45638848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 4789310 - 4789354
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
4789354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 17130081 - 17130037
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
17130037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 33067732 - 33067684
Alignment:
| Q |
203 |
taagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
33067732 |
taagctaaaatatcgttttagtccttgcaaatatgtctcgttttggttt |
33067684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 46183686 - 46183730
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
46183730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 4323827 - 4323870
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
4323827 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttg |
4323870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 19721071 - 19721028
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttt |
19721028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 38150851 - 38150894
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
38150894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Original strand, 7818782 - 7818828
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7818782 |
agctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
7818828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 32454293 - 32454251
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttgg |
248 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32454293 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
32454251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 990089 - 990134
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
990089 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
990134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3679627 - 3679672
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
3679627 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
3679672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3753571 - 3753526
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
3753571 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttt |
3753526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 6567495 - 6567450
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
6567495 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
6567450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7867130 - 7867175
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
7867130 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttt |
7867175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10887234 - 10887279
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
10887234 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttt |
10887279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12360604 - 12360649
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
12360604 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagttt |
12360649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12361012 - 12361057
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
12361012 |
gctaaaatatggttttagtccctgcaaatttgcctcgttttggttt |
12361057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13260320 - 13260275
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
13260320 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
13260275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14007490 - 14007535
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
14007490 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
14007535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15211512 - 15211557
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
15211512 |
gctaaaatatggttttggtccctgtaaatatgtctcgttttggttt |
15211557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16060597 - 16060641
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
16060597 |
gctaaaatatggttttggtccct-caaatatgcctcgttttggttt |
16060641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 17984334 - 17984379
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
17984334 |
gctaaaatatggtttgagtccctgcaaatatgcctcgttttggttt |
17984379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 17984700 - 17984655
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
17984700 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
17984655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 18079659 - 18079618
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18079659 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19622656 - 19622701
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
19622656 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
19622701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19623016 - 19622971
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
19623016 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
19622971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21391097 - 21391142
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
21391097 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
21391142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22674204 - 22674249
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
22674204 |
gctaaaatatggtttaggtccatgcaaatatgtctcgttttggttt |
22674249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22953555 - 22953510
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
22953555 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
22953510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25658015 - 25658060
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25658015 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttt |
25658060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26191360 - 26191405
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
26191360 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
26191405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26191733 - 26191688
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
26191733 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
26191688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26324946 - 26324901
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
26324946 |
gctaaaatatgattttagtccatgcaaatatgcctcgttttggttt |
26324901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26442564 - 26442609
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
26442564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
26442609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29072861 - 29072816
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
29072861 |
gctaaaatatggttttagtccctgcaaatatgcctcgctttggttt |
29072816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29688427 - 29688382
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29688427 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
29688382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31060788 - 31060833
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
31060788 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttt |
31060833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31258340 - 31258385
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
31258340 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttt |
31258385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32626530 - 32626575
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
32626530 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
32626575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33045356 - 33045401
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
33045356 |
gctaaaatttggttttggtccctgcaaatatgcctagttttggttt |
33045401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 33234911 - 33234870
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
33234911 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttg |
33234870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 35005445 - 35005486
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
35005445 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
35005486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 36912854 - 36912895
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
36912854 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37624747 - 37624792
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
37624747 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttt |
37624792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39025380 - 39025336
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39025380 |
gctaaaatatggttttggtccctgcaaa-atgcctcgttttggttt |
39025336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41358662 - 41358617
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
41358662 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
41358617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41738797 - 41738842
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
41738797 |
gctaaaatatggttttggtccctgcaaatatgcctcattttagttt |
41738842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42482980 - 42483025
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
42482980 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
42483025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 42483270 - 42483225
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
42483270 |
gctaaaatatggttttggtccctgcaaatatgctttgttttggttt |
42483225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44158041 - 44157996
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
44158041 |
gctaaaatatggtttttgtccctgcaaatatgcctagttttggttt |
44157996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44641431 - 44641386
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
44641431 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
44641386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45290458 - 45290503
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
45290458 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
45290503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45290819 - 45290774
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45290819 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttt |
45290774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 48609593 - 48609548
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
48609593 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
48609548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 48955715 - 48955760
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
48955715 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
48955760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 48956065 - 48956020
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
48956065 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
48956020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 49074052 - 49074011
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
49074052 |
gctaaaatatggttttggtccttgtaaatatgcttcgttttg |
49074011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 50428874 - 50428915
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
50428874 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttg |
50428915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 50429208 - 50429163
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
50429208 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
50429163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 50799131 - 50799176
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
50799131 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
50799176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 52254184 - 52254229
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
52254184 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
52254229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 52254478 - 52254437
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
52254478 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
52254437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 17129691 - 17129735
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttt |
17129735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 5058989 - 5058950
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttg |
5058950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 7350733 - 7350690
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttt |
7350690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 15335292 - 15335249
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttt |
15335249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 18899842 - 18899885
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttt |
18899885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 18900130 - 18900087
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttt |
18900087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 27521575 - 27521618
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
27521575 |
aagctaaaatatggttttagtccctgcaaatatgtctcgttttg |
27521618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 207 - 246
Target Start/End: Original strand, 29579322 - 29579361
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcatttt |
29579361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 31258699 - 31258656
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttt |
31258656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 32906237 - 32906198
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttg |
32906198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 39025112 - 39025151
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttg |
39025151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Original strand, 2939934 - 2939975
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttt |
2939975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 3679985 - 3679944
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
3679985 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttg |
3679944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 7350663 - 7350630
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggttt |
7350630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7819102 - 7819057
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7819102 |
gctaaaatatggttttaatctctgcaaatatgcctcgttttggttt |
7819057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7867356 - 7867311
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||||||| |
|
|
| T |
7867356 |
gctaaaatatggttttggtccctgcaaatatgtcttattttggttt |
7867311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8364915 - 8364870
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
8364915 |
gctaaaatatagttttggtccccgcaaatatgtctcgttttggttt |
8364870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 11822364 - 11822323
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
11822364 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
11822323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12158691 - 12158736
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
12158691 |
gctaaaatatggttttagtctctgcaaatatgcatcgttttggttt |
12158736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13259989 - 13260034
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
13259989 |
gctaaaatatggttttagtcgctgcaaatatggctcgttttggttt |
13260034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15058765 - 15058720
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
15058765 |
gctaaaatattgttttgatccctgcaaatatgtctcgttttggttt |
15058720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 15211783 - 15211750
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
15211783 |
ttttggtccttgcaaatatgtctcgttttggttt |
15211750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15466133 - 15466178
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
15466133 |
gctaaaatatggttttggtccttacggatatgcctcattttggttt |
15466178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16026574 - 16026619
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16026574 |
gctaaaatataattttggtccctgcaaatatccctcgttttggttt |
16026619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 17130011 - 17129978
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
17130011 |
ttttggtccttgcaaatatgtctcgttttggttt |
17129978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20948756 - 20948801
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||| ||||| |
|
|
| T |
20948756 |
gctaaaatatggttttggtccctacaaatatgtctcgtttgggttt |
20948801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22919976 - 22919931
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
22919976 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttagttt |
22919931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24510307 - 24510262
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
24510307 |
gctaaaatatggttttggtccctgcaaatatggttcgttttagttt |
24510262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26699605 - 26699561
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
26699605 |
gctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttt |
26699561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 28507188 - 28507221
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggttt |
28507221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31061150 - 31061105
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
31061150 |
gctaaaatatggttttgatccctgcaaatatatctcgttttggttt |
31061105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 32420170 - 32420203
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
32420170 |
ttttggtccttacaaatatgcctcgttttggttt |
32420203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34002636 - 34002681
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| |||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
34002636 |
gctaaagtatgattttggtccctgcaaatatgtctcgttttggttt |
34002681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34002939 - 34002894
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
34002939 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttt |
34002894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39303675 - 39303720
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||| ||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttt |
39303720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39747475 - 39747519
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
39747475 |
gctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttt |
39747519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 40718473 - 40718432
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | |||||| |
|
|
| T |
40718473 |
gctaaaatatggttttggtccctgcaaatatgcatagttttg |
40718432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41881094 - 41881139
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||| ||||||||||||| |
|
|
| T |
41881094 |
gctaaaatatggttttagtccctccaaatatgtctcgttttggttt |
41881139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46868576 - 46868531
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
46868576 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
46868531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 48609237 - 48609282
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
48609237 |
gctaaaatatggttttagtcccggcaaatatgtctcgttttggttt |
48609282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Complemental strand, 49073980 - 49073947
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
49073980 |
ttttggtccttgcaaatatgcctcattttggttt |
49073947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 4565335 - 4565295
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
4565335 |
gctaaaatatggttctggtccctgcaaatatgtctcgtttt |
4565295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 32035787 - 32035747
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
32035787 |
gctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 45368847 - 45368803
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttt |
45368803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 154)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 26878076 - 26878025
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26878076 |
ttataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
26878025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 23676456 - 23676406
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23676456 |
tataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
23676406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1614903 - 1614858
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1614903 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
1614858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3975550 - 3975595
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3975550 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
3975595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3975837 - 3975792
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3975837 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
3975792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6589022 - 6589067
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6589022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
6589067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8144657 - 8144612
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8144657 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
8144612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9659688 - 9659643
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9659688 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
9659643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10358367 - 10358322
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10358367 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
10358322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16853588 - 16853543
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16853588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
16853543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23399613 - 23399658
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23399613 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
23399658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25988748 - 25988703
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25988748 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
25988703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29198661 - 29198616
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29198661 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
29198616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30223794 - 30223749
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30223794 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttggttt |
30223749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45228917 - 45228872
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45228917 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
45228872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 48192487 - 48192442
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48192487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
48192442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 1614553 - 1614605
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1614553 |
attataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
1614605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 11766920 - 11766963
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
11766963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 48192260 - 48192303
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
48192303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1006836 - 1006881
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1006836 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
1006881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5233809 - 5233854
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5233809 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
5233854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5354769 - 5354814
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5354769 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttt |
5354814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6108335 - 6108380
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6108335 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
6108380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7431952 - 7431997
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7431952 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
7431997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8144296 - 8144341
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
8144296 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
8144341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8555798 - 8555753
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
8555798 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
8555753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12894401 - 12894356
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
12894401 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
12894356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 17999466 - 17999511
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
17999466 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
17999511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 17999720 - 17999675
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
17999720 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
17999675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19561155 - 19561200
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19561155 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
19561200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19757749 - 19757794
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19757749 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
19757794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 20388259 - 20388320
Alignment:
| Q |
190 |
acataaataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| | || |||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
20388259 |
acataaataaatttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
20388320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 23399975 - 23399930
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
23399975 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
23399930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25092161 - 25092206
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25092161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
25092206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25092547 - 25092502
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
25092547 |
gctaaaatatggttttggtccctgcaaatatgcctctttttggttt |
25092502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25988386 - 25988431
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25988386 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
25988431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 27037594 - 27037639
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27037594 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttt |
27037639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 27458400 - 27458445
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
27458400 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
27458445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28262714 - 28262759
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
28262714 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
28262759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28911905 - 28911860
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28911905 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
28911860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 198 - 247
Target Start/End: Complemental strand, 35015227 - 35015178
Alignment:
| Q |
198 |
aattataagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
35015227 |
aattataggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
35015178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 35104290 - 35104249
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggttt |
35104249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35837925 - 35837970
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35837925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35837970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35838336 - 35838291
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35838336 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35838291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 37372903 - 37372858
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37372903 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
37372858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39438742 - 39438787
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
39438742 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttt |
39438787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41054235 - 41054190
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
41054235 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
41054190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44403248 - 44403203
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
44403248 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttt |
44403203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 44508721 - 44508766
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44508721 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
44508766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44509053 - 44509008
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44509053 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
44509008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46759659 - 46759704
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
46759659 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
46759704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 48852445 - 48852490
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
48852445 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttt |
48852490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 6847117 - 6847073
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
6847073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 18022710 - 18022658
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
18022710 |
attataggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
18022658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 29198297 - 29198349
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29198297 |
attataggctaaaatatggttttggtccctgcaaatatatctcgttttggttt |
29198349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 5355114 - 5355071
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttt |
5355071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 6079808 - 6079851
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
6079808 |
aagctaaaatatggttttagtccctgcaaatatgcctcgttttg |
6079851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 6589271 - 6589228
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttt |
6589228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 16941049 - 16941006
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttt |
16941006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 23676135 - 23676178
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
23676178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 30352563 - 30352606
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30352606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 38186369 - 38186408
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttg |
38186408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 39520727 - 39520688
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttg |
39520688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 45021495 - 45021537
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttgg |
248 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
45021495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgg |
45021537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 1271590 - 1271553
Alignment:
| Q |
214 |
atggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttt |
1271553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 246
Target Start/End: Complemental strand, 1559713 - 1559664
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
|||||| | |||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
1559713 |
taattaaaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1559664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2945844 - 2945799
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
2945844 |
gctaaaatatgtttttggtccctacaaatatgcctcgttttggttt |
2945799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5234203 - 5234158
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
5234203 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttt |
5234158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5308324 - 5308369
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
5308324 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttt |
5308369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6509209 - 6509254
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
6509209 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttcgttt |
6509254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 6509469 - 6509424
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
6509469 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
6509424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 6911246 - 6911201
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
6911246 |
gctaaaatatggttttggttcctgcaaatatacctcgttttggttt |
6911201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 11767274 - 11767229
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
11767274 |
gctaaaatatggttttggtccctgcaaatatgcttcattttggttt |
11767229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 12932782 - 12932741
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
12932782 |
gctaaaatatgtttttggtccctgcaaatatgcctcgttttg |
12932741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13769775 - 13769820
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
13769775 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
13769820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13770080 - 13770035
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
13770080 |
gctaaaatatggttttagtccctgcaaatatgccccgttttggttt |
13770035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14543711 - 14543756
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
14543711 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
14543756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16940763 - 16940808
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
16940763 |
gctaacatatggttttggtccctgcaaatatgcctcggtttggttt |
16940808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19561449 - 19561404
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
19561449 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
19561404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 21223747 - 21223702
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
21223747 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttt |
21223702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23816671 - 23816716
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
23816671 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttt |
23816716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28911578 - 28911623
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
28911578 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
28911623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30223462 - 30223507
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30223462 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttt |
30223507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31310678 - 31310633
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
31310678 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 31732102 - 31732143
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
31732102 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
31732143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 31732450 - 31732409
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
31732450 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttg |
31732409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34878124 - 34878079
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
34878124 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
34878079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35210514 - 35210469
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
35210514 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
35210469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39439028 - 39438983
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
39439028 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttt |
39438983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39520399 - 39520444
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
39520399 |
gctaaaatatggttttggtccatccaaatatgtctcgttttggttt |
39520444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39832907 - 39832952
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
39832907 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
39832952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39833235 - 39833190
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
39833235 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttt |
39833190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 41053843 - 41053884
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
41053843 |
gctaaaatatggttttggtccctgcaaatatgcctcattttg |
41053884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44344788 - 44344743
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
44344788 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
44344743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 44568327 - 44568372
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
44568327 |
gctaaaatatggttttggtccctgcaaatataactcgttttggttt |
44568372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44568689 - 44568644
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
44568689 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
44568644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45021855 - 45021810
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
45021855 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
45021810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45073315 - 45073360
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||||||||| |
|
|
| T |
45073315 |
gctaaaatatggttttagtccctgcaaataagcctcgttttggttt |
45073360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45073640 - 45073595
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
45073640 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
45073595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46648714 - 46648669
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
46648714 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttt |
46648669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46759941 - 46759896
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
46759941 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttt |
46759896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46828945 - 46828990
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
46828945 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttggttt |
46828990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 48359074 - 48359029
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
48359074 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
48359029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
211 |
aatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 20355409 - 20355453
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggtt |
250 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
20355409 |
gctaaaatatgattttgatccttgcaaatatgactcgttttggtt |
20355453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 32189388 - 32189344
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttt |
32189344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 18022366 - 18022413
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
18022366 |
aagctaaaatatggttttagtccccgcaaatatgtctcgttttggttt |
18022413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 18311579 - 18311626
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
18311579 |
aagctaaaatatggttttagtctctacaaatatgcctcgttttggttt |
18311626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 25547256 - 25547299
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttt |
25547299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 28529206 - 28529163
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggttt |
28529163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 34877777 - 34877820
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttt |
34877820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 44841359 - 44841398
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttg |
44841398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 251
Target Start/End: Original strand, 6954862 - 6954904
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttt |
6954904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 251
Target Start/End: Original strand, 37372441 - 37372483
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttt |
37372483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 45228611 - 45228661
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
45228611 |
tataggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttt |
45228661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 1007228 - 1007187
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
1007228 |
gctaaaatatggttttagtccctccaaatatgcctcgttttg |
1007187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 1559344 - 1559385
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
1559344 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttg |
1559385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1974010 - 1974055
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
1974010 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
1974055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3807865 - 3807910
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||| | |||||||||| ||||||||||||| |
|
|
| T |
3807865 |
gctaaaatatagttttggttcctgcaaatatgtctcgttttggttt |
3807910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 9659356 - 9659397
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
9659356 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttg |
9659397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10358002 - 10358047
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| | || |||| |||||||||||||||||||||||| |
|
|
| T |
10358002 |
gctaaaatatgatcttagtccctgcaaatatgcctcgttttggttt |
10358047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 14739003 - 14738962
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
14739003 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttg |
14738962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 16940835 - 16940868
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
16940835 |
ttttggtccttgcaaatatgcctcattttggttt |
16940868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19783816 - 19783861
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
19783816 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
19783861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 20355488 - 20355521
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
20355488 |
ttttggtccttgcaaatatgtctcgttttggttt |
20355521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21223406 - 21223451
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||||||| |
|
|
| T |
21223406 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttt |
21223451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21554394 - 21554439
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| || ||||||||||||||||||||| |
|
|
| T |
21554394 |
gctaaaatatgattttagtccctgaaaatatgcctcgttttggttt |
21554439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 21554752 - 21554711
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
21554752 |
gctaaaatatggttttagtccctgcaaatatgccttgttttg |
21554711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22539931 - 22539976
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||| ||||||||| |
|
|
| T |
22539931 |
gctaaaatatggttttgatccctccaaatatgcctcattttggttt |
22539976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24717531 - 24717486
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | | |||||| ||||||||||||| |
|
|
| T |
24717531 |
gctaaaatatggttttggtccctaccaatatgtctcgttttggttt |
24717486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 25547489 - 25547448
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
25547489 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
25547448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26877679 - 26877724
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
26877679 |
gctaaaatatggttttgatctctgcaaatatgtctcgttttggttt |
26877724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 30352903 - 30352862
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
30352903 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttg |
30352862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30709643 - 30709598
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| ||||||||||||| |
|
|
| T |
30709643 |
gctaaaatatgattttagtccctgcaaatatgtctcgttttggttt |
30709598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 236
Target Start/End: Original strand, 31853542 - 31853579
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatat |
236 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31853542 |
attataagctaaaatatgtttttggtccctgcaaatat |
31853579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32189077 - 32189122
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||||||| |
|
|
| T |
32189077 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttt |
32189122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35104079 - 35104124
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35104079 |
gctaaaatataattttggtccctgcaaatatgtctcgttttggttt |
35104124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35469881 - 35469926
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
35469881 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttt |
35469926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35470279 - 35470234
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
35470279 |
gctaaaatttggttttgatccctgcaaatatgcctcattttggttt |
35470234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35665878 - 35665923
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
35665878 |
gctaaaatatggttttaatccctacaaatatgcctcgttttggttt |
35665923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 35665948 - 35665981
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
35665948 |
ttttggtccttgcaaatatgtctcgttttggttt |
35665981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 37527421 - 37527376
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| || |||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttt |
37527376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38486789 - 38486744
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||| ||||||||||| |
|
|
| T |
38486789 |
gctaaaatatggttttgatccctgtaaatatgccccgttttggttt |
38486744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39719354 - 39719399
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||| ||||||||| |
|
|
| T |
39719354 |
gctaaaatatggttttagtccctacaaatatgcctcattttggttt |
39719399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39719641 - 39719596
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
39719641 |
gctaaaatatggttttagtccctgcaaatatggctcgttttagttt |
39719596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41365213 - 41365168
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttt |
41365168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43300613 - 43300658
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttt |
43300658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 44402961 - 44403006
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| | ||||||||| |
|
|
| T |
44402961 |
gctaaaatatggttttagtccctgcaaatatgccccattttggttt |
44403006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44958505 - 44958460
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| | |||||||| ||||||||||||| |
|
|
| T |
44958505 |
gctaaaatatgattttggtccctacaaatatgtctcgttttggttt |
44958460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46304087 - 46304132
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| || | |||||||||||||||||||||||| |
|
|
| T |
46304087 |
gctaaaatatgattttagttcctgcaaatatgcctcgttttggttt |
46304132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46829311 - 46829266
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| ||||||||| |
|
|
| T |
46829311 |
gctaaaatatggttttgatccctgcaaatatgtctcattttggttt |
46829266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 17854151 - 17854195
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttt |
17854195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 233
Target Start/End: Complemental strand, 35666138 - 35666102
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaa |
233 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
35666138 |
taattataggctaaaatatggtttttgtccttgcaaa |
35666102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 148)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 2636994 - 2636947
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2636994 |
aagctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
2636947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 5917118 - 5917172
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
5917118 |
taattataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
5917172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 24443748 - 24443698
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24443748 |
tataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
24443698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1105147 - 1105102
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1105147 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
1105102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1381610 - 1381565
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1381610 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
1381565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5917459 - 5917414
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5917459 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
5917414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6912498 - 6912543
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6912498 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
6912543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9179919 - 9179874
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9179919 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
9179874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19565830 - 19565785
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19565830 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
19565785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19685379 - 19685334
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19685379 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
19685334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20660949 - 20660994
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20660949 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
20660994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35928065 - 35928110
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35928065 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
35928110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38170515 - 38170560
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38170515 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
38170560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40764416 - 40764461
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40764416 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
40764461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 9532532 - 9532489
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttt |
9532489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 20985728 - 20985771
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
20985771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 4203441 - 4203502
Alignment:
| Q |
189 |
cacataaataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4203441 |
cacataaatagtta-aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4203502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 30800490 - 30800540
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
30800490 |
tataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30800540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45139 - 45184
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45139 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
45184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 1104859 - 1104900
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1104859 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttg |
1104900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1381248 - 1381293
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1381248 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
1381293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2217495 - 2217540
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
2217495 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
2217540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2217853 - 2217808
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
2217853 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
2217808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5614529 - 5614484
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5614529 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
5614484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 5904009 - 5904050
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5904009 |
gctaaaatatggttttgctccttgcaaatatgcctcgttttg |
5904050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5950177 - 5950222
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5950177 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
5950222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 6118498 - 6118453
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6118498 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
6118453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7075573 - 7075618
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7075573 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
7075618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10743725 - 10743770
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10743725 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
10743770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10744053 - 10744008
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10744053 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttt |
10744008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 11799457 - 11799412
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
11799457 |
gctaaaatatggttttagtccgtgcaaatatgcctcgttttggttt |
11799412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14318046 - 14318091
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
14318046 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttt |
14318091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16038378 - 16038423
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16038378 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
16038423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18046347 - 18046302
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18046347 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18046302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18258526 - 18258481
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
18258526 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
18258481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 18633600 - 18633645
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18633600 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18633645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18633960 - 18633915
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18633960 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18633915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19565468 - 19565513
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
19565468 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
19565513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19685018 - 19685063
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
19685018 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
19685063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20661310 - 20661265
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
20661310 |
gctaaaatatggttttggtccgtgcaaatatgcttcgttttggttt |
20661265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20690734 - 20690779
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
20690734 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
20690779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 20986088 - 20986047
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20986088 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttg |
20986047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24443381 - 24443426
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
24443381 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
24443426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25561998 - 25561953
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
25561998 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
25561953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28213374 - 28213419
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
28213374 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
28213419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28550828 - 28550873
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28550828 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
28550873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28863511 - 28863556
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28863511 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
28863556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28863837 - 28863792
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28863837 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
28863792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28871993 - 28871948
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28871993 |
gctaaattatggttttggtccctgcaaatatgcctcgttttggttt |
28871948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29172524 - 29172569
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
29172569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29172885 - 29172840
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29172885 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
29172840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29692745 - 29692790
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29692745 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
29692790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29875724 - 29875679
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29875724 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
29875679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30800849 - 30800804
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
30800849 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30800804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30888161 - 30888206
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
30888161 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
30888206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35167164 - 35167119
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35167164 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
35167119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35609304 - 35609349
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35609304 |
gctaaaatatggttttggtccatgcaaatatgcatcgttttggttt |
35609349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35876689 - 35876734
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35876689 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
35876734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35877051 - 35877006
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35877051 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35877006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35928457 - 35928412
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35928457 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35928412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 36578082 - 36578037
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
36578082 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
36578037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37271360 - 37271405
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37271360 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
37271405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40029496 - 40029451
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
40029496 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
40029451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40764779 - 40764734
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
40764779 |
gctaaaatatggttttgctccctgcaaatatgcctcgttttggttt |
40764734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 6912855 - 6912811
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
6912811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 35609635 - 35609591
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35609591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 4736206 - 4736249
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggt |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4736206 |
gctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 28108159 - 28108116
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttt |
28108116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Original strand, 29855613 - 29855659
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
29855613 |
agctaaaatatgattttggtccttggaaatatgcctcattttggttt |
29855659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 293829 - 293870
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
293829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
293870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1286683 - 1286728
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
1286683 |
gctaaaatatggtgttggtccctacaaatatgcctcgttttggttt |
1286728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2636670 - 2636715
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
2636670 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttt |
2636715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3850300 - 3850345
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
3850300 |
gctaaaatatggttttagtccctgcaaatctgcctcgttttggttt |
3850345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4736541 - 4736496
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
4736541 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttt |
4736496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9179594 - 9179639
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
9179594 |
gctaaaatatggttttagtccttgcaaatatgattcgttttggttt |
9179639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 10408929 - 10408970
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
10408929 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
10408970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 10409325 - 10409284
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
10409325 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
10409284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13990894 - 13990849
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||||||||||| |
|
|
| T |
13990894 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttt |
13990849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15635706 - 15635661
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
15635706 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttt |
15635661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 18258163 - 18258208
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
18258163 |
gctaaaatatggttttggtccctgcaaatatggctcattttggttt |
18258208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 23382296 - 23382251
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
23382296 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
23382251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25561706 - 25561751
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
25561706 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
25561751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26133184 - 26133229
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
26133184 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
26133229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26133412 - 26133367
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
26133412 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
26133367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29151850 - 29151805
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
29151850 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttt |
29151805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29366948 - 29366903
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
29366948 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
29366903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31037740 - 31037695
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
31037740 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
31037695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33336025 - 33335980
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
33336025 |
gctaaaatatggttttagtccctgcaaatatgactcgttttggttt |
33335980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34125308 - 34125353
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
34125308 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
34125353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35166912 - 35166957
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
35166912 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
35166957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 36577723 - 36577768
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
36577723 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
36577768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 37271705 - 37271664
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
37271705 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
37271664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38786160 - 38786205
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
38786160 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
38786205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39379609 - 39379564
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
39379609 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
39379564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 40038495 - 40038536
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
40038495 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttg |
40038536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40038857 - 40038812
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
40038857 |
gctaaaatatgattttggtccctgcaaatatgccttgttttggttt |
40038812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40167787 - 40167832
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
40167787 |
gctaaagtatggttttagtccctgcaaatatgcctcgttttggttt |
40167832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42207243 - 42207288
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
42207243 |
gctaaaatatggttttagtccttgtaaatatgtctcgttttggttt |
42207288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42553643 - 42553688
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42553643 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttt |
42553688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 12145181 - 12145141
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttg |
12145141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 16038738 - 16038694
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
16038694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 38452394 - 38452354
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttg |
38452354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 45501 - 45458
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttt |
45458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 206 - 245
Target Start/End: Original strand, 17070536 - 17070575
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttt |
245 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
17070536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 23381945 - 23381996
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
23381945 |
ttataggctaaaatatggttttagtccctgcaaatatgtctggttttggttt |
23381996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 27916761 - 27916718
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttt |
27916718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 39379242 - 39379285
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttt |
39379285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 42596814 - 42596771
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttt |
42596771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 251
Target Start/End: Original strand, 32888691 - 32888733
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttt |
32888733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2032939 - 2032894
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
2032939 |
gctaaattatggttttagtccctgcaaatatgtctcgttttggttt |
2032894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 3850594 - 3850553
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttt |
3850553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 4203769 - 4203728
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
4203769 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
4203728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5104000 - 5103955
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||| ||||||||| |
|
|
| T |
5104000 |
gctaaaatatggttttggttcctgcaaatatgtctcattttggttt |
5103955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 5614167 - 5614208
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
5614167 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
5614208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10830530 - 10830575
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
10830530 |
gctaaaatatggttttggtctcttcaaatatgcctagttttggttt |
10830575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11799130 - 11799175
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| | |||||||||| |
|
|
| T |
11799130 |
gctaaaatatggttttagtccctgcaaatatgcattgttttggttt |
11799175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12144908 - 12144953
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||| ||||||||| |
|
|
| T |
12144908 |
gctaaaatatggtttttgtccctgtaaatatgcctctttttggttt |
12144953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15916287 - 15916332
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
15916287 |
gctaaaagatggttttggtccctgcaaatatgtctcattttggttt |
15916332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 18046039 - 18046080
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
18046039 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
18046080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18286740 - 18286695
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| |||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
18286740 |
gctaaaaaatggttttagtccctgcaaatatacctcgttttggttt |
18286695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20416361 - 20416406
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||| |||||||| |
|
|
| T |
20416361 |
gctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 21050912 - 21050871
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
21050912 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttg |
21050871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21124914 - 21124959
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
21124914 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
21124959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24781990 - 24782035
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
24781990 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttt |
24782035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25779161 - 25779116
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
25779161 |
gctaaaatatggttttagtccctgcaaatatgcttcattttggttt |
25779116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 28213446 - 28213479
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggttt |
28213479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 29151517 - 29151558
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
29151517 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttg |
29151558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29693089 - 29693044
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||||||| |
|
|
| T |
29693089 |
gctaaaatatgattttagtccctgcaaatatgcttcgttttggttt |
29693044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29875401 - 29875446
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
29875401 |
gctaaaatatgattttaatccctgcaaatatgcctcgttttggttt |
29875446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 31602139 - 31602188
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggtt |
250 |
Q |
| |
|
|||| |||||||||| |||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
31602139 |
tataggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32108809 - 32108854
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
32108809 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttagttt |
32108854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34125631 - 34125586
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||| ||||||||| |
|
|
| T |
34125631 |
gctaaaatatggttttagtccctgtaaatatgcctcattttggttt |
34125586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 35166169 - 35166112
Alignment:
| Q |
194 |
aaataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| || |||| ||||||||||| |||| |||||| ||| ||||||||||||| |
|
|
| T |
35166169 |
aaataattttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttt |
35166112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 36973354 - 36973399
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
36973354 |
gctaaaatatggttttggtctctccaaatatgtctcgttttggttt |
36973399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 36973709 - 36973668
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||| |
|
|
| T |
36973709 |
gctaaaatatggttttggtccctggaaatatgtctcgttttg |
36973668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38182086 - 38182041
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38182086 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38189045 - 38189090
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38189045 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38209312 - 38209267
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38209312 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38216270 - 38216315
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
38216270 |
gctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38496781 - 38496736
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
38496781 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
38496736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38555082 - 38555038
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
38555082 |
gctaaaatatggttt-ggtccctgcaaatatgcctcattttggttt |
38555038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38962807 - 38962852
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||||||| |
|
|
| T |
38962807 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttt |
38962852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40029142 - 40029187
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||| ||||||||||||| |
|
|
| T |
40029142 |
gctaaaatatggttttagtccctgtaaatatgtctcgttttggttt |
40029187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40168007 - 40167962
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
40168007 |
gctaaaatattgttttagtccatgcaaatatgtctcgttttggttt |
40167962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 42994069 - 42994110
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
42994069 |
gctaaaatatggttttagtccctgcaaatatgactcgttttg |
42994110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 16616370 - 16616414
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||| |||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttt |
16616414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 20691094 - 20691050
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||| | |||||||||| ||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttt |
20691050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 42207570 - 42207527
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtccta-caaatatgcctcgttttggttt |
42207527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 54816 - 54861
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54816 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
54861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 50075 - 50032
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
50032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 55176 - 55133
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
55133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 82705 - 82660
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
82705 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
82660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 82342 - 82387
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
82342 |
gctaaaatatggttttggtccctgcaaatacgtctcgttttggttt |
82387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 75763 - 75718
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
75763 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
75718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 75360 - 75405
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
75360 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttggttt |
75405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 176)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4211562 - 4211607
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4211562 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
4211607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 6827547 - 6827592
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6827547 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
6827592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13530712 - 13530667
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13530712 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
13530667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14487803 - 14487848
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14487803 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
14487848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23245232 - 23245277
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23245232 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
23245277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24774046 - 24774091
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24774046 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
24774091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29499183 - 29499228
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29499183 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
29499228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30046791 - 30046746
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30046791 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
30046746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30061132 - 30061087
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30061132 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
30061087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35464381 - 35464336
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35464381 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
35464336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 42848390 - 42848345
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42848390 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
42848345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 43231388 - 43231343
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43231388 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
43231343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46115415 - 46115460
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46115415 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
46115460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46128549 - 46128594
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46128549 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
46128594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46292393 - 46292438
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46292393 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
46292438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 52543423 - 52543468
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52543423 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttt |
52543468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 29499543 - 29499500
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
29499500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 47022743 - 47022786
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttt |
47022786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 53915678 - 53915725
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53915678 |
ttataggctaaaatatggttttggtccctgcaaatatgcctcgttttg |
53915725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 251
Target Start/End: Original strand, 2322093 - 2322139
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2322093 |
agctaaaatatggttttggtccctacaaatatgcctcgttttggttt |
2322139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 6353638 - 6353592
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6353638 |
agctaaaatatggttttggtccctgcaaatatacctcgttttggttt |
6353592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5827972 - 5827927
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
5827972 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttt |
5827927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8760780 - 8760735
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8760780 |
gctaaaatatggttttagtccttgcaaatatggctcgttttggttt |
8760735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8904887 - 8904932
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
8904887 |
gctaaaatatagttttggtccctgcaaatatgcctcgttttggttt |
8904932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12152492 - 12152447
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12152492 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
12152447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13064464 - 13064419
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
13064464 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
13064419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13073760 - 13073805
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13073760 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13073805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13074124 - 13074079
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13074124 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttt |
13074079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13631229 - 13631274
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13631229 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13631274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13631598 - 13631553
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13631598 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttt |
13631553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13764614 - 13764659
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13764614 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13764659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14791805 - 14791760
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
14791805 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
14791760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16712690 - 16712645
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16712690 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
16712645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 18205157 - 18205202
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
18205157 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
18205202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20144730 - 20144685
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
20144730 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttt |
20144685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20291987 - 20292032
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
20291987 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
20292032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22099544 - 22099589
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22099544 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
22099589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22584288 - 22584333
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
22584288 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttt |
22584333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23778965 - 23779010
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
23778965 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
23779010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25423925 - 25423970
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25423925 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
25423970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25424311 - 25424266
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25424311 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
25424266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26412583 - 26412538
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
26412583 |
gctaaaatatggttttggtccctgcaaatatggctcgttttggttt |
26412538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28448835 - 28448880
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
28448835 |
gctaaaatatggttttagtccttacaaatatgcctcgttttggttt |
28448880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 28449213 - 28449172
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28449213 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttg |
28449172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29420536 - 29420491
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
29420536 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
29420491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29463912 - 29463867
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29463912 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
29463867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32208543 - 32208588
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
32208543 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
32208588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32365095 - 32365140
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
32365095 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
32365140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35415632 - 35415587
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35415632 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
35415587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35464019 - 35464064
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35464019 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35464064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35763648 - 35763693
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35763648 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
35763693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41345854 - 41345899
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
41345854 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
41345899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43231089 - 43231134
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
43231089 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
43231134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45505893 - 45505848
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
45505893 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
45505848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 47532667 - 47532626
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttt |
47532626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 51738410 - 51738369
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51738410 |
gctaaaatatggttttggtccatgcaaatatgcctcgttttg |
51738369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 52017506 - 52017551
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
52017506 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
52017551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 52017869 - 52017824
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
52017869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
52017824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 52442091 - 52442046
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
52442091 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttggttt |
52442046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 53717173 - 53717128
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
53717173 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
53717128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 53916046 - 53916001
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
53916046 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
53916001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 54903474 - 54903429
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
54903474 |
gctaaaatatggttttggtccctgcaaatatgccccgttttggttt |
54903429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 19903653 - 19903609
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
19903609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 30060763 - 30060811
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30060763 |
attataggttaaaatatggttttggtccctgcaaatatgcctcgttttg |
30060811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 35420701 - 35420657
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttt |
35420657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 52543725 - 52543681
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttt |
52543681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 14791502 - 14791545
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttt |
14791545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 15555506 - 15555549
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
15555549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 20144423 - 20144466
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttt |
20144466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 38054549 - 38054592
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
38054592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 41619902 - 41619945
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
41619945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 51545966 - 51545923
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
51545923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 54208822 - 54208779
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
54208779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 55072709 - 55072666
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
55072666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 246
Target Start/End: Original strand, 5202929 - 5202967
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
5202967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 9289262 - 9289312
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
9289262 |
tataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
9289312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 26412186 - 26412236
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
26412186 |
tataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
26412236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 35119615 - 35119565
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35119615 |
tataggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 36050284 - 36050334
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
36050284 |
tatacgctaaaatatggttttggtccccgcaaatatgtctcgttttggttt |
36050334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 123535 - 123580
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
123535 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
123580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 210 - 251
Target Start/End: Original strand, 2034544 - 2034585
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttt |
2034585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2034854 - 2034809
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
2034854 |
gctaaaatatggttttagtcccagcaaatatgcctcgttttggttt |
2034809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2180221 - 2180266
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
2180221 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
2180266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2322431 - 2322386
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
2322431 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
2322386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5052583 - 5052538
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5052583 |
gctacaatatggttttagtccctgcaaatatgcctcgttttggttt |
5052538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5827656 - 5827701
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
5827656 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
5827701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5882553 - 5882597
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
5882553 |
gctaaaatatggttttagtcct-gcaaatatgcctcgttttggttt |
5882597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 6827873 - 6827828
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
6827873 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
6827828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8191390 - 8191345
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
8191390 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
8191345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11285504 - 11285549
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
11285549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 11693120 - 11693079
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
11693120 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
11693079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12791973 - 12791928
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
12791973 |
gctaaaatatgatttttgtccctgcaaatatgcctcgttttggttt |
12791928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 13064160 - 13064201
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
13064160 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
13064201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13479273 - 13479318
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
13479318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13479610 - 13479565
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
13479610 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
13479565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14488186 - 14488141
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
14488186 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
14488141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19321858 - 19321813
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
19321858 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttt |
19321813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22099911 - 22099866
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
22099911 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
22099866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 23245594 - 23245549
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
23245594 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
23245549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24474962 - 24474917
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
24474962 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
24474917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 27008085 - 27008130
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
27008085 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
27008130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28809012 - 28809057
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
28809012 |
gctaaaatatggttttagtccttgcaaatatgtatcgttttggttt |
28809057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28809179 - 28809134
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
28809179 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
28809134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29380909 - 29380864
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
29380909 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
29380864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31560332 - 31560377
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
31560332 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttggttt |
31560377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31560694 - 31560649
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
31560694 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
31560649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31812212 - 31812167
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
31812212 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttt |
31812167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 32365482 - 32365437
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
32365482 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttt |
32365437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34361804 - 34361849
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
34361804 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
34361849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35119293 - 35119338
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35119293 |
gctaaaatatggttttggtccctgcaaatatgctccgttttggttt |
35119338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 36054149 - 36054104
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
36054149 |
gctaaaatacggttttggtccctgcaaatatgcctcattttggttt |
36054104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 37557194 - 37557153
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttg |
37557153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41324889 - 41324844
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
41324889 |
gctaaaatatggttttgatctctgcaaatatgcctcgttttggttt |
41324844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42823777 - 42823822
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42823777 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttt |
42823822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42848028 - 42848073
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
42848028 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttt |
42848073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 44925486 - 44925531
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
44925486 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
44925531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44925844 - 44925799
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttt |
44925799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45505601 - 45505646
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
45505601 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
45505646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46088059 - 46088014
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
46088059 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
46088014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46292650 - 46292605
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
46292650 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
46292605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 47136170 - 47136125
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
47136125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 50714241 - 50714286
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
50714241 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
50714286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 50714564 - 50714519
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
50714564 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
50714519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 51545630 - 51545675
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
51545630 |
gctaaaatatggttttagtccctgcaaatatacctcgttttggttt |
51545675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 51708694 - 51708739
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
51708694 |
gctaaaatatggttttagtccctgcaaatatggctcgttttggttt |
51708739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 51709026 - 51708981
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
51709026 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
51708981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 51738138 - 51738183
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
51738138 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttt |
51738183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 51763201 - 51763156
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttt |
51763156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 53308067 - 53308022
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
53308067 |
gctaaaatatggttttggtccctgcaaatatgtcccgttttggttt |
53308022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 55072390 - 55072435
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
55072390 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
55072435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 55805087 - 55805042
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||| |
|
|
| T |
55805087 |
gctaaaatatagttttggttcttgcaaatatgccttgttttggttt |
55805042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 9445951 - 9445995
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
9445995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 245
Target Start/End: Original strand, 12152150 - 12152194
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttt |
245 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
12152150 |
tataggctaaaatatggttttggtccctgcaaatatgactcgttt |
12152194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 18205521 - 18205477
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
18205477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 5797817 - 5797774
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttt |
5797774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 7639895 - 7639942
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| || |||||||||| |
|
|
| T |
7639895 |
aagctaaaatatggttttggtccctacaaatatgtcttgttttggttt |
7639942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 15555639 - 15555592
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
15555639 |
aagctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
15555592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 249
Target Start/End: Original strand, 16712331 - 16712373
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggt |
249 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggt |
16712373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 237
Target Start/End: Complemental strand, 30091120 - 30091082
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatg |
237 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
30091120 |
attataggctaaaatatggttttggtccatgcaaatatg |
30091082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 35415295 - 35415345
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| || |||||||| |||||||||||| |
|
|
| T |
35415295 |
tataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttt |
35415345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 35763959 - 35763909
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||| |||| |||| |||| ||||||||||||||||||| |
|
|
| T |
35763959 |
tataggctaaaatatgattttagtccctgcagatatgcctcgttttggttt |
35763909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 36702363 - 36702317
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| || | |||| ||||||||||||||||||| |
|
|
| T |
36702363 |
agctaaaatatggttttagttcctgcagatatgcctcgttttggttt |
36702317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 53716917 - 53716967
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
53716917 |
tataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttt |
53716967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 123893 - 123852
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttt |
123852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4279334 - 4279289
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| ||||||||||||| |
|
|
| T |
4279334 |
gctaaaatatgattttagtccctgcaaatatggctcgttttggttt |
4279289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 8905233 - 8905192
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
8905233 |
gctaaaatatggttttggtccctgtaaatatgcctcattttg |
8905192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 9289634 - 9289593
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttt |
9289593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 11692763 - 11692804
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
11692763 |
gctaaaatgtggttttggtccctgcaaatatgccccgttttg |
11692804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 13530380 - 13530421
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
13530380 |
gctaaaatatggttttgctccctgcaaatatgtctcgttttg |
13530421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13764806 - 13764761
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||| |
|
|
| T |
13764806 |
gctaaaatatggttttggtccctgtaaatatgtttcgttttggttt |
13764761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14594207 - 14594252
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
14594207 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggttt |
14594252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19321571 - 19321616
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| || ||| ||||||||||||||||| |
|
|
| T |
19321571 |
gctaaaatatgattttggtccctgtaaacatgcctcgttttggttt |
19321616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24474601 - 24474645
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| |||||||||||| |
|
|
| T |
24474601 |
gctaaaatatggttttagtcct-gcaaatatgcatcgttttggttt |
24474645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25358539 - 25358494
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| || ||||||| ||||||||||||| |
|
|
| T |
25358539 |
gctaaaatatgattttggtccctgtaaatatgtctcgttttggttt |
25358494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26314331 - 26314286
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| || ||||||| ||||||||||||| |
|
|
| T |
26314331 |
gctaaaatatggttttgatccctgaaaatatgtctcgttttggttt |
26314286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 27008401 - 27008360
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttt |
27008360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29380669 - 29380714
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
29380669 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
29380714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29463611 - 29463656
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
29463611 |
gctaaaatatggttttatttcctgcaaatatgcctcgttttggttt |
29463656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31811926 - 31811971
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
31811926 |
gctaaaatatggttttgatccctgcaaatatgtatcgttttggttt |
31811971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 32208900 - 32208859
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32208900 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttg |
32208859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 36050359 - 36050392
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttt |
36050392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 36702001 - 36702042
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
36702001 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
36702042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37556842 - 37556887
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||| |||||||| |
|
|
| T |
37556842 |
gctaaaatatggttttagaccttgcaaatatacctcgatttggttt |
37556887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41346217 - 41346172
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
41346217 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttt |
41346172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41620255 - 41620210
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || |||||||| |||||||||||| |
|
|
| T |
41620255 |
gctaaaatatggttttagtccctgtaaatatgcatcgttttggttt |
41620210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 42824090 - 42824049
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||| |
|
|
| T |
42824090 |
gctaaaatatggttttggtccctgcaaatatgtcttgttttg |
42824049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45474595 - 45474550
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||| |||||||| |
|
|
| T |
45474595 |
gctaaaatatggttttagtccctgcaaatatgcttcgctttggttt |
45474550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45593585 - 45593540
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
45593585 |
gctaaaatatggttttagtctctgcaaatatgtctcgttttggttt |
45593540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46115778 - 46115733
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||| | ||||||||||||| |
|
|
| T |
46115778 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttt |
46115733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46128912 - 46128867
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||| | ||||||||||||| |
|
|
| T |
46128912 |
gctaaaatatggttttagtccctgcaaatacgtctcgttttggttt |
46128867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 47023104 - 47023059
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
47023104 |
gctaaaatatggttttgatccctgcaaatatgtttcgttttggttt |
47023059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 52430099 - 52430054
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
52430099 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttt |
52430054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 52441764 - 52441805
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
52441764 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
52441805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 55482467 - 55482422
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| | |||||||||||||||||||||| |
|
|
| T |
55482467 |
gctaaaatatgattttagtccctccaaatatgcctcgttttggttt |
55482422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 35420393 - 35420437
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttt |
35420437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 43368467 - 43368511
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
43368511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 178)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9262154 - 9262109
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9262154 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
9262109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22008889 - 22008844
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22008889 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
22008844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25615976 - 25616021
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25615976 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
25616021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28552382 - 28552337
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28552382 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
28552337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31480137 - 31480182
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31480137 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
31480182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40370588 - 40370543
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40370588 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
40370543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 45002022 - 45002067
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45002022 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
45002067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46186770 - 46186725
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46186770 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
46186725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 49323783 - 49323828
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49323783 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
49323828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 51550083 - 51550128
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51550083 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
51550128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 54608519 - 54608564
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54608519 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
54608564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 9603925 - 9603873
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
9603925 |
attataggctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
9603873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 22156295 - 22156247
Alignment:
| Q |
203 |
taagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22156295 |
taagctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
22156247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 30034109 - 30034153
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttt |
30034153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 8940522 - 8940479
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
8940479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 11463231 - 11463278
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
11463231 |
aagctaaaatatggttttggttcctgcaaatatgcctcgttttggttt |
11463278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 25610131 - 25610088
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25610131 |
aagctaaaatatggttttggtccctgcaaatatgcctcgttttg |
25610088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 54608868 - 54608817
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
54608868 |
ttataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
54608817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 474412 - 474362
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
474412 |
tataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
474362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 9603625 - 9603675
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9603625 |
tataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
9603675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 30106224 - 30106174
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30106224 |
tataggctaaaatatggttttggtccctgcaaatatacctcgttttggttt |
30106174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 47336585 - 47336535
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
47336585 |
tataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
47336535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 474045 - 474090
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
474045 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
474090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1721451 - 1721406
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1721451 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
1721406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3151751 - 3151796
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3151751 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
3151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3152110 - 3152065
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3152110 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
3152065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3387603 - 3387558
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3387603 |
gctaaaatatggttttggtcgctgcaaatatgcctcgttttggttt |
3387558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3830515 - 3830470
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3830515 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
3830470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4034718 - 4034763
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4034718 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
4034763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4035052 - 4035007
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4035052 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttt |
4035007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4513264 - 4513309
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4513264 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4513309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4950038 - 4950083
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4950038 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4950083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9261790 - 9261835
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
9261790 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
9261835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10976979 - 10977024
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10976979 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
10977024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12740908 - 12740953
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12740908 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
12740953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12741270 - 12741225
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12741270 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
12741225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14772212 - 14772257
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14772212 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
14772257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15979339 - 15979384
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15979339 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
15979384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19844580 - 19844535
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
19844580 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
19844535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20612897 - 20612852
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
20612897 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
20612852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 21159816 - 21159771
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
21159816 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
21159771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 21553890 - 21553935
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21553890 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttagttt |
21553935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25710869 - 25710824
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
25710869 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
25710824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26089731 - 26089776
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26089731 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
26089776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26090077 - 26090032
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
26090077 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
26090032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28427607 - 28427562
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28427607 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
28427562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28452148 - 28452193
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
28452148 |
gctaaaatatggttttggtccttgcaaatatgtcttgttttggttt |
28452193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28552022 - 28552067
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
28552022 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttt |
28552067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29490742 - 29490697
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
29490742 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
29490697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29678025 - 29678070
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29678025 |
gctaaaatatagttttggtctttgcaaatatgcctcgttttggttt |
29678070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30034471 - 30034426
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30034471 |
gctaaaatatggttttgctccttgcaaatatgtctcgttttggttt |
30034426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31480499 - 31480454
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31480499 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttt |
31480454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 32119583 - 32119538
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32119583 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
32119538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37506868 - 37506913
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37506868 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
37506913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 37507221 - 37507176
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37507221 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
37507176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39437108 - 39437063
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
39437108 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
39437063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43441271 - 43441316
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
43441271 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
43441316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 43441602 - 43441557
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
43441602 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
43441557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45002384 - 45002339
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45002384 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
45002339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 46622128 - 46622083
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46622128 |
gctaaaatatggttttggtccttgcaaatatgtttcgttttggttt |
46622083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 47005518 - 47005473
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
47005518 |
gctaaaatatggttttggtccctgcaaatattcctcgttttggttt |
47005473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 47336229 - 47336274
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47336229 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
47336274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 48924239 - 48924194
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
48924239 |
gctaaaatatggttttggtccctgtaaatatgcctcgttttggttt |
48924194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 50009283 - 50009242
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50009283 |
gctaaactatggttttggtccttgcaaatatgcctcgttttg |
50009242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 51550445 - 51550400
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
51550445 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
51550400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 51834609 - 51834654
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
51834609 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
51834654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 52342196 - 52342241
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
52342196 |
gctaaaatatggttttggtccctgcaaatatgcctccttttggttt |
52342241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 2486900 - 2486856
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
2486856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 14633547 - 14633591
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
14633591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 50196301 - 50196345
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
50196345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 1721092 - 1721135
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttt |
1721135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 3361819 - 3361772
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
3361819 |
aagctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
3361772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 8555305 - 8555262
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttt |
8555262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 30130153 - 30130204
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
30130153 |
ttataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
30130204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 35569133 - 35569090
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
35569090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 53701676 - 53701617
Alignment:
| Q |
192 |
ataaataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| ||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
53701676 |
ataaataaatatgggctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
53701617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 27681686 - 27681636
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
27681686 |
tataggctaaaatatggttctggtctctgcaaatatgcctcgttttggttt |
27681636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 28942521 - 28942571
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
28942521 |
tataggctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
28942571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 51760118 - 51760072
Alignment:
| Q |
205 |
agctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
51760118 |
agctaaaatatggttctagtccctgcaaatatgcctcgttttggttt |
51760072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3830135 - 3830180
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
3830135 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
3830180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4814541 - 4814586
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
4814541 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
4814586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5345688 - 5345643
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
5345688 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
5345643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7588319 - 7588364
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
7588319 |
gctaaaatatagttttggtccctgcaaatatgccttgttttggttt |
7588364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7957225 - 7957180
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7957225 |
gctaaaatatgattttggtccctgcaaatatgcgtcgttttggttt |
7957180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8510215 - 8510260
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
8510215 |
gctaaaatatggttttagtccctgcaaatatgcctctttttggttt |
8510260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9597094 - 9597049
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
9597094 |
gctaaaatatggttttgttccctgcaaatatgcttcgttttggttt |
9597049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9863403 - 9863358
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9863403 |
gctaaaatatggttttagtctctgcaaatatgcctcgttttggttt |
9863358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13584366 - 13584321
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
13584366 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
13584321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15016389 - 15016434
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
15016389 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
15016434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15979700 - 15979655
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
15979700 |
gctaaaatatggttttggtccctacaaatatgtctcgttttggttt |
15979655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16123140 - 16123185
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
16123140 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttt |
16123185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 19656542 - 19656583
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
19656542 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttg |
19656583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20611021 - 20611066
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
20611021 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
20611066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22008527 - 22008572
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
22008527 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
22008572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22016045 - 22016090
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
22016045 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
22016090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25609768 - 25609813
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
25609768 |
gctaaaatatggttttggtctttacaaataagcctcgttttggttt |
25609813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26799889 - 26799934
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
26799889 |
gctaaaatatggttttagtccctgtaaatatgcctcgttttggttt |
26799934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28452375 - 28452330
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
28452375 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttt |
28452330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28942904 - 28942859
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
28942904 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttggttt |
28942859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29445955 - 29446000
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
29445955 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
29446000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 29955661 - 29955620
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttt |
29955620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 30004816 - 30004775
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttt |
30004775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30128285 - 30128330
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||||||||||||| |
|
|
| T |
30128285 |
gctaaaatatggttttggtccctgcaaacatgtctcgttttggttt |
30128330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30268506 - 30268551
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
30268506 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
30268551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34238599 - 34238644
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
34238599 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
34238644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35177256 - 35177301
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
35177256 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttt |
35177301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35565509 - 35565554
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
35565509 |
gctaaaatatggttttgttccctgcaaatatacctcgttttggttt |
35565554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39288574 - 39288619
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
39288574 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
39288619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 39288897 - 39288852
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39288897 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
39288852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 39436719 - 39436764
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
39436719 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
39436764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40277823 - 40277868
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40277823 |
gctaaaatgtggttttggtccctgcaaatatgcttcgttttggttt |
40277868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40545565 - 40545610
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
40545565 |
gctaaaatatggttttggtccctgcaaatatgactcgttttagttt |
40545610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43440496 - 43440541
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
43440496 |
gctaaaatatggttttagtccttgcaaatatgtctcgttttagttt |
43440541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 44802283 - 44802328
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
44802283 |
gctaaaatatggttttagtccctgcaaatatgcgtcgttttggttt |
44802328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 45313862 - 45313821
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
45313862 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttg |
45313821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 45320978 - 45320933
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
45320978 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
45320933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 46751272 - 46751317
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
46751272 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
46751317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 47005155 - 47005200
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
47005155 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttt |
47005200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 47114488 - 47114533
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
47114488 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttggttt |
47114533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 51500684 - 51500639
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
51500684 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttt |
51500639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 51834941 - 51834896
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
51834941 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
51834896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 52342582 - 52342537
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
52342582 |
gctaaaatatggtttttgtctctgcaaatatgcctcgttttggttt |
52342537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 53113444 - 53113485
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
53113444 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
53113485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 16679678 - 16679722
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttt |
16679722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 246
Target Start/End: Original strand, 19844266 - 19844306
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgtttt |
246 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19844266 |
gctaaaatatggttttggtccctacaaatatgcctcgtttt |
19844306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 29955300 - 29955340
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttg |
29955340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 30004454 - 30004494
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttg |
30004494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 45006247 - 45006203
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
45006203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 3387268 - 3387311
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttt |
3387311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 7956868 - 7956915
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| || ||||||||| |
|
|
| T |
7956868 |
aagctaaaatatggttttggtctttgtaaatatgcttcattttggttt |
7956915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 20757403 - 20757446
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttt |
20757446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 40723121 - 40723164
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttt |
40723164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 49324143 - 49324100
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttt |
49324100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 198 - 237
Target Start/End: Original strand, 50008913 - 50008952
Alignment:
| Q |
198 |
aattataagctaaaatatggttttggtccttgcaaatatg |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
50008913 |
aattataagctagaatatggttttggtccctgcaaatatg |
50008952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 4321938 - 4321992
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| || |||||||||||||| || |||||||||||||| ||| ||||||||| |
|
|
| T |
4321938 |
taattttaggctaaaatatggttctgatccttgcaaatatgtctcattttggttt |
4321992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 29446210 - 29446160
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
29446210 |
tataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttt |
29446160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 275445 - 275486
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
275445 |
gctaaaatatggttttagtccctgcaactatgcctcgttttg |
275486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 863282 - 863327
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||| |||| |
|
|
| T |
863282 |
gctaaaatatgattttggtccatgcaaatatgtctcgttttagttt |
863327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4513619 - 4513574
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
4513619 |
gctaaaatatggttttactccctgcaaatatgtctcgttttggttt |
4513574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4814897 - 4814853
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
4814897 |
gctaaaatatggttttagtcct-gcaaatatgtctcgttttggttt |
4814853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7518091 - 7518136
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||||| |||| |
|
|
| T |
7518091 |
gctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttt |
7518136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9596759 - 9596804
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttt |
9596804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10977340 - 10977295
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
10977340 |
gctaaaatatggatttaatccctgcaaatatgcctcgttttggttt |
10977295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 11463480 - 11463435
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttt |
11463435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12673645 - 12673690
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| || ||||||||||||||||||||| |
|
|
| T |
12673645 |
gctaaaatatagttttagtccctgtaaatatgcctcgttttggttt |
12673690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13514576 - 13514531
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||| | |||||||||| ||||||||||||| |
|
|
| T |
13514576 |
gctaaaatatgattttggtacctgcaaatatgtctcgttttggttt |
13514531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 15286157 - 15286202
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
15286157 |
gctaaaatatggttttaatccctgcaaatatgcttcgttttggttt |
15286202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 21159454 - 21159495
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
21159454 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
21159495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 22155930 - 22155971
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
22155930 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
22155971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 25353200 - 25353241
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
25353200 |
gctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 237
Target Start/End: Complemental strand, 28418901 - 28418868
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatg |
237 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
28418901 |
aagctaaaatatggttttggtccctgcaaatatg |
28418868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 28427246 - 28427291
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
28427246 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttt |
28427291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29525106 - 29525151
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
29525106 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttt |
29525151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29678386 - 29678341
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
29678386 |
gctaaaatatgattttggtccctgcaaatatgccctgttttggttt |
29678341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29686545 - 29686590
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
29686545 |
gctagaatatggttttggtccatgcaaatatgtcttgttttggttt |
29686590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 30426225 - 30426185
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
30426225 |
gctaaaatatggttttagtcct-gcaaatatgcctcgttttg |
30426185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 30552477 - 30552432
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
30552477 |
gctaaaatatcgttttagtccatgcaaatatgtctcgttttggttt |
30552432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31869955 - 31869910
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
31869955 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttagttt |
31869910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34238914 - 34238869
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
34238914 |
gctaaaatatggttttagtccccgcaaatatgcttcgttttggttt |
34238869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 35936781 - 35936826
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||||| | |||||||||||| |
|
|
| T |
35936781 |
gctaaaatatggttttggtccctacaaatatacttcgttttggttt |
35936826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 36673244 - 36673199
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttt |
36673199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 38232242 - 38232283
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
38232242 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttg |
38232283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 39072212 - 39072171
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
39072212 |
gctaaaatatggttttagttcctgcaaatatgcctcgttttg |
39072171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 40169653 - 40169612
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
40169653 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
40169612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 40279334 - 40279293
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
40279334 |
gctaaaatatggttttggtctttgcaaatatgtcttgttttg |
40279293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40370286 - 40370331
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||| |||| |
|
|
| T |
40370286 |
gctaaaatatgattttggtccctgcaaatatgtctcgttttagttt |
40370331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40979709 - 40979664
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
40979709 |
gctaaaatatggttttaatccctgcaaatatggctcgttttggttt |
40979664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 46186410 - 46186451
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttg |
46186451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 50196656 - 50196611
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||||||||||| |||| |
|
|
| T |
50196656 |
gctaaaatatggttttagtccctacaaatatgcctcgtttttgttt |
50196611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
53113757 |
gctaaaatatggttttgatccatgcaaatatacctcgttttg |
53113716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 2486581 - 2486625
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttt |
2486625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 7518444 - 7518400
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttt |
7518400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 19297947 - 19297907
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttg |
19297907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 215 - 251
Target Start/End: Complemental strand, 25610061 - 25610025
Alignment:
| Q |
215 |
tggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttt |
25610025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 35533281 - 35533325
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttt |
35533325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 36672957 - 36673009
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| | |||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
36672957 |
attataggataaaatatggttttggtctctgcaaatatgtcttgttttggttt |
36673009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 251
Target Start/End: Complemental strand, 38232594 - 38232554
Alignment:
| Q |
211 |
aatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggttt |
38232554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 43440785 - 43440741
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttt |
43440741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 147)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2481556 - 2481511
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2481556 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
2481511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3172531 - 3172486
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3172531 |
gctaaaatatgattttggtccttgcaaatatgcctcgttttggttt |
3172486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4423896 - 4423941
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4423896 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
4423941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5334752 - 5334797
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5334752 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
5334797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5335039 - 5334994
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5335039 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
5334994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 14003741 - 14003696
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14003741 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
14003696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15842822 - 15842777
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15842822 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
15842777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16522992 - 16523037
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16522992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
16523037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16523324 - 16523279
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16523324 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
16523279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20131680 - 20131635
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20131680 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
20131635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24358617 - 24358662
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24358617 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
24358662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 25705448 - 25705403
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25705448 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
25705403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29859871 - 29859826
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29859871 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
29859826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43592047 - 43592092
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43592047 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttt |
43592092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 146328 - 146372
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
146372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 1137983 - 1138027
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttt |
1138027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 15842464 - 15842507
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
15842507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Original strand, 24483399 - 24483446
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
24483399 |
aagctaaaatatggctttagtccttgcaaatatgcctcgttttggttt |
24483446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 29859490 - 29859533
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttt |
29859533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 204 - 251
Target Start/End: Complemental strand, 42696204 - 42696157
Alignment:
| Q |
204 |
aagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
42696204 |
aagctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
42696157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 44559057 - 44559108
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
44559057 |
ttataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
44559108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 10374770 - 10374820
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10374770 |
tatatgctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
10374820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 1497611 - 1497652
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1497611 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttg |
1497652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2481194 - 2481239
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2481194 |
gctaaaatatggttttggtacttgcaaatatgtctcgttttggttt |
2481239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 3838267 - 3838218
Alignment:
| Q |
202 |
ataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
3838267 |
ataagctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
3838218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4042611 - 4042656
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
4042611 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
4042656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4424184 - 4424139
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4424184 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
4424139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13215061 - 13215106
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
13215061 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13215106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14003410 - 14003455
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
14003410 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
14003455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16673770 - 16673725
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
16673770 |
gctaaaatatggttttggtccctgcaaatatgcctcgtttttgttt |
16673725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16900205 - 16900160
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16900205 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
16900160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 16993596 - 16993551
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16993596 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
16993551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 18113090 - 18113135
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
18113090 |
gctaaaatatggttttggtccctgcaaatatgcctagttttggttt |
18113135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19184150 - 19184105
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19184150 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
19184105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20131318 - 20131363
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
20131318 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
20131363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 20939324 - 20939279
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
20939279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 22881614 - 22881659
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22881614 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
22881659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 23732327 - 23732282
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23732327 |
gctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24358944 - 24358899
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
24358944 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
24358899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 24483890 - 24483845
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
24483890 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
24483845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 25705086 - 25705131
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
25705086 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
25705131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 26814228 - 26814183
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
26814228 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
26814183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 27109074 - 27109119
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
27109074 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttt |
27109119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 27310877 - 27310922
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
27310877 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 27311068 - 27311023
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
27311068 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttggttt |
27311023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 29865510 - 29865465
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
29865510 |
gctaaaatatggttttagtccttgcaaatatgcttcgttttggttt |
29865465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 30215423 - 30215468
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30215423 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
30215468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 31644842 - 31644887
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
31644842 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
31644887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33576116 - 33576071
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
33576116 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
33576071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33732863 - 33732908
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33732863 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
33732908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 33733240 - 33733195
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33733240 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
33733195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34317799 - 34317844
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
34317799 |
gctaaaatatgattttggtccctgcaaatatgcctcgttttggttt |
34317844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 36815834 - 36815789
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
36815834 |
gctaaaatatggttttggtccatgcaaatatgtctcgttttggttt |
36815789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37271740 - 37271785
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37271740 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
37271785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 37272101 - 37272056
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
37272101 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
37272056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 37911119 - 37911074
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37911119 |
gctaaaatatggttttggtccctgcaaatatgcttcgttttggttt |
37911074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 38980252 - 38980207
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
38980252 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
38980207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40124967 - 40125012
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
40124967 |
gctaaaatatggttttggtccctgcaaatatgcctcattttggttt |
40125012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41451838 - 41451883
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
41451838 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
41451883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 42695869 - 42695914
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42695869 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
42695914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43788859 - 43788904
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43788859 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
43788904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 1497943 - 1497899
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttt |
1497899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 44559407 - 44559363
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
44559363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 44985623 - 44985667
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
44985667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 9195215 - 9195160
Alignment:
| Q |
196 |
ataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| || |||||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
9195215 |
ataattgtaggctaaaatatggttttagaccctgcaaatatgcctcgttttggttt |
9195160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 23990193 - 23990150
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttt |
23990150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 25954423 - 25954384
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttg |
25954384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 42358702 - 42358745
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
42358745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 251
Target Start/End: Complemental strand, 45442705 - 45442650
Alignment:
| Q |
197 |
taattataag-ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
45442705 |
taattataaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttt |
45442650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 251
Target Start/End: Complemental strand, 36806892 - 36806850
Alignment:
| Q |
209 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttt |
36806850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 40302343 - 40302293
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
40302343 |
tataggctaaaatatggttttagtccctgcaaatatggctcgttttggttt |
40302293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 43597146 - 43597200
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| || |||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
43597146 |
taattttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttt |
43597200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 146689 - 146644
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
146689 |
gctaaaatatggttttggtccctgcaaatatgtttcgttttggttt |
146644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2265396 - 2265351
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
2265396 |
gctaaaatatgattttagtccttgcaaatatgtctcgttttggttt |
2265351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3172021 - 3172066
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
3172021 |
gctaaaatatgattttggtccctgcaaatatgcctcattttggttt |
3172066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 3671004 - 3671045
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3671004 |
gctaaaatatggttttagtccatgcaaatatgcctcgttttg |
3671045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 3671187 - 3671146
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttt |
3671146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4042889 - 4042844
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
4042889 |
gctaaaatatggtttaggtccctgcaaatatgtctcgttttggttt |
4042844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4794131 - 4794176
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
4794131 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
4794176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5790559 - 5790604
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| || |||| |||||||||||||||||||||||| |
|
|
| T |
5790559 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttt |
5790604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5790898 - 5790853
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
5790898 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
5790853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8046330 - 8046375
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
8046330 |
gctaaaatatggttttaatccctgcaaatatgcctcgttttggttt |
8046375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 8046647 - 8046602
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
8046647 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
8046602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 9195055 - 9195100
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
9195055 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
9195100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10375068 - 10375023
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
10375068 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
10375023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10671631 - 10671676
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
10671631 |
gctaaaatatggttttggtccctgcaaatatatctcgttttggttt |
10671676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 10671940 - 10671895
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
10671940 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
10671895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 11713486 - 11713531
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
11713486 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
11713531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 11713844 - 11713799
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||||||||||| |
|
|
| T |
11713844 |
gctaaaatacggttttagtccctgcaaatatgcctcgttttggttt |
11713799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 11788415 - 11788370
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
11788415 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
11788370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 13215364 - 13215319
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
13215364 |
gctaaaatatgggtttggtccctgcaaatatgtctcgttttggttt |
13215319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16673412 - 16673457
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
16673412 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
16673457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 17302142 - 17302097
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
17302142 |
gctaaaatatggttttggttcctgcaaatatgtctcgttttggttt |
17302097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 17541383 - 17541428
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
17541383 |
gctaaaatatggttttagtccccgcaaatatgcctcgttttggttt |
17541428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 18113453 - 18113408
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
18113453 |
gctaaaatatggttttggtccctacaaatatgcttcgttttggttt |
18113408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19183783 - 19183828
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
19183783 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
19183828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23989839 - 23989884
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
23989839 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
23989884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 26813867 - 26813912
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
26813867 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
26813912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29865222 - 29865267
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
29865267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31226076 - 31226031
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
31226076 |
gctaaaatatggttttactccctgcaaatatgcctcgttttggttt |
31226031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31326251 - 31326206
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
31326251 |
gctaaaatatagttttagtccttgcaaatatgcctcgttttagttt |
31326206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 31909477 - 31909433
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31909477 |
gctaaaatatggttttggtccctgcaaatatgcctc-ttttggttt |
31909433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32476096 - 32476141
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
32476096 |
gctaaaatatggttttgatccctgcaaatatgcctcattttggttt |
32476141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33575753 - 33575798
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
33575753 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttggttt |
33575798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 34318082 - 34318041
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
34318082 |
gctaaaatatggttttggtccctacaaatatgcctcgttttg |
34318041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 34964158 - 34964113
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
34964158 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttagttt |
34964113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 36622251 - 36622296
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
36622251 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
36622296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37228734 - 37228779
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
37228734 |
gctaaaatatggttttggtccctgcaaatatgtatcgttttggttt |
37228779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 37910757 - 37910802
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
37910757 |
gctaaaatatggttttgatccttgcaaatatgcctcattttagttt |
37910802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38639413 - 38639458
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
38639413 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
38639458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 38731830 - 38731875
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
38731830 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttt |
38731875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41694002 - 41693957
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
41694002 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
41693957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41791311 - 41791266
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
41791311 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 43710707 - 43710662
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||||||||||||||| |
|
|
| T |
43710707 |
gctaaaatatgattttagcccttgcaaatatgcctcgttttggttt |
43710662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 44073806 - 44073765
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
44073806 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttg |
44073765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 3832643 - 3832591
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3832643 |
attataggttaaaatatggttttggtccctgcaaatatgtttcgttttggttt |
3832591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 36622582 - 36622538
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
36622538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 13850881 - 13850838
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttt |
13850838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 17912808 - 17912765
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttt |
17912765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 14392780 - 14392834
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||| | |||||||||||||| ||| ||| |||||||||||||||| |||| |
|
|
| T |
14392780 |
taattataggttaaaatatggttttagtcattgtaaatatgcctcgttttagttt |
14392834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 30215875 - 30215825
Alignment:
| Q |
201 |
tataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
30215875 |
tataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttt |
30215825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1138358 - 1138313
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||| |||| |
|
|
| T |
1138358 |
gctaaaatatggttttgatccctgcaaatatgtctcgttttagttt |
1138313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 251
Target Start/End: Complemental strand, 4794468 - 4794427
Alignment:
| Q |
210 |
aaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttt |
4794427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4842865 - 4842910
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttt |
4842910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 7814247 - 7814292
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| |||| || ||||||||||||||||||||| |
|
|
| T |
7814247 |
gctaaaatattgttttagtccctgtaaatatgcctcgttttggttt |
7814292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7814736 - 7814691
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||| ||||||||| |
|
|
| T |
7814736 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttt |
7814691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 10664985 - 10665026
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
10664985 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
10665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12835326 - 12835371
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||| ||||||||| |
|
|
| T |
12835326 |
gctaaaatatgattttagtccctgcaaatatgcctcattttggttt |
12835371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 13802487 - 13802532
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || |||| |||||| |||||||||||||| |
|
|
| T |
13802487 |
gctaaaatatggttttagttcttgtaaatattcctcgttttggttt |
13802532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 17541775 - 17541730
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
17541775 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
17541730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 20658062 - 20658107
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||| |||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
20658062 |
gctaaaacatggttttagtccctgcaaatatgccttgttttggttt |
20658107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 23732040 - 23732085
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
23732040 |
gctaaaatatgattttgatccctgcaaatatgtctcgttttggttt |
23732085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 26239159 - 26239118
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
26239159 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
26239118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29182169 - 29182214
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
29182169 |
gctaaaatatgattttggtccttgcaaatatgtttcattttggttt |
29182214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 29831815 - 29831860
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
29831815 |
gctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 29831885 - 29831918
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggttt |
29831918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 31225716 - 31225757
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
31225716 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttg |
31225757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 32691314 - 32691359
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
32691314 |
gctaaaatatggttttagtttctgcaaatatgcctcgttttggttt |
32691359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 40125288 - 40125243
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| |||| |||| |
|
|
| T |
40125288 |
gctaaaatatgattttggtccctgcaaatatgcctcatttttgttt |
40125243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 40301976 - 40302021
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||| |||| |
|
|
| T |
40301976 |
gctaaaatatggttttagtccctgcaaatatgcctcattttagttt |
40302021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 41693675 - 41693720
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
41693675 |
gctaaaatatggttttagtccctgcaaatatgtttcgttttggttt |
41693720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 43671935 - 43671980
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| || |||||||| |||||||||||| |
|
|
| T |
43671935 |
gctaaaatatggtttttgtccctgtaaatatgcttcgttttggttt |
43671980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 43789191 - 43789146
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| || | ||||||||||| |||||||||||| |
|
|
| T |
43789191 |
gctaaaatatggttttagttcctgcaaatatgcttcgttttggttt |
43789146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44985983 - 44985938
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
44985983 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
44985938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 29182440 - 29182396
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttt |
29182396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 35155298 - 35155338
Alignment:
| Q |
211 |
aatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttt |
35155338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 41791020 - 41791064
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttt |
41791064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 3934 - 3872
Alignment:
| Q |
189 |
cacataaataattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
3934 |
cacaaaaataattaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
3872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3533 - 3578
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
3533 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
3578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2779 - 2824
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
2779 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
2824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5210 - 5255
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5210 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
5255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 5230 - 5275
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5230 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
5275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 2659 - 2614
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
2659 |
gctaaaatatggttttggtccctgcaaatatgccttgttttggttt |
2614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 2335 - 2380
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
2335 |
gctataatatggttttggtccctgcaaatattccttgttttggttt |
2380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9027 - 8982
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
9027 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
8982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 8734 - 8778
Alignment:
| Q |
207 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
8778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4311 - 4266
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4311 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 14698 - 14743
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
14698 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
14743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 15011 - 14966
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
15011 |
gctaaaatatggttttagtccctgcaaatatgtctcattttggttt |
14966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 27363 - 27318
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
27363 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
27318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 27072 - 27105
Alignment:
| Q |
218 |
ttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttt |
27105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 47926 - 47971
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
47926 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
47971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 48228 - 48185
Alignment:
| Q |
208 |
taaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttt |
48185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 223171 - 223126
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
223171 |
gctaaaatatggttttggtccctgcaaatatgtctcactttggttt |
223126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 365980 - 366025
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
365980 |
gctaaaatatggttttaatccttgcaaatatgcctcgttttggttt |
366025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 366272 - 366227
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
366272 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
366227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 148281 - 148236
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
148281 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
148236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 5391 - 5445
Alignment:
| Q |
197 |
taattataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| | |||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
5391 |
taattaaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
5445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 5707 - 5662
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
5707 |
gctaaaatatggttttagtccctgcaaatatgtcttgttttggttt |
5662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 1312 - 1357
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
1312 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
1357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 1643 - 1598
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
1643 |
gctaaaatatgaatttagtccctgcaaatatgcctcgttttggttt |
1598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 8548 - 8593
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
8548 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
8593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 288 - 243
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
288 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12526 - 12571
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
12526 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
12571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 4042 - 4087
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
4042 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
4087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 19224 - 19269
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
19224 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttt |
19269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 4287 - 4242
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
4287 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
4242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 19469 - 19424
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
19469 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
19424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 22054 - 22009
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
22054 |
gctaaaatatggttttggtcccttcaaatttgcctcgttttggttt |
22009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 34932 - 34977
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||| || |||| |||||||||||||||||||||||| |
|
|
| T |
34932 |
gctaaaatatggtcttagtccctgcaaatatgcctcgttttggttt |
34977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 17965 - 17920
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
17965 |
gctaaaatatggttttagtccctgcaaatatgcctcgtttcggttt |
17920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 3753 - 3798
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
3753 |
gctaaaatatggttttggtccctgcaaatatgctttgttttggttt |
3798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 4084 - 4033
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| ||||||||| ||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
4084 |
ttataggctaaaatacggttttggtccctgcaaatatgtctcgttttagttt |
4033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 12183 - 12228
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
12183 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
12228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 12535 - 12490
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
12535 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
12490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 10169 - 10214
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
10169 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttt |
10214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 10520 - 10469
Alignment:
| Q |
200 |
ttataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||||| || |||||||||| |
|
|
| T |
10520 |
ttataggctaaaatatggttttagtccctgcaaatatgtctggttttggttt |
10469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 2882 - 2841
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2882 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 2502 - 2543
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
2502 |
gctaaaatatggttttgatccctgcaaatatgcttcgttttg |
2543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 94058 - 94103
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
94058 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
94103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 94329 - 94284
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggttt |
94284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 18042 - 18000
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttgg |
248 |
Q |
| |
|
|||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
18042 |
gctaaaatatggttttagtccctgcgaatatgcctcgttttgg |
18000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 3290 - 3245
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
3290 |
gctaaaatatggttttaatccctgcaaatatgtctcgttttggttt |
3245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 24373 - 24418
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
24373 |
gctaaaatatggttttagtcactgcaaatatgtctcgttttggttt |
24418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 16725 - 16770
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
16725 |
gctaaaatatgattttggtccctgcaaatatatctcgttttggttt |
16770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 35083 - 35038
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| ||||||||||||| |
|
|
| T |
35083 |
gctaaaatatggttttgatccgtacaaatatgtctcgttttggttt |
35038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 8331 - 8372
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
8331 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
8372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 8641 - 8600
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttg |
247 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
8641 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttg |
8600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 44205 - 44160
Alignment:
| Q |
206 |
gctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| || ||||||||| |
|
|
| T |
44205 |
gctaaaatatggctttggtccctgcaaatatgcttcattttggttt |
44160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 189323 - 189375
Alignment:
| Q |
199 |
attataagctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
251 |
Q |
| |
|
|||||| |||||||||| |||||| | | || ||||||||||||||||||||| |
|
|
| T |
189323 |
attataggctaaaatatagttttgattcctgtaaatatgcctcgttttggttt |
189375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University