View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2396_low_33 (Length: 217)
Name: NF2396_low_33
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2396_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 35017570 - 35017365
Alignment:
| Q |
1 |
ggcctccttgtactatgttttggtatcaaactatcaattgaattgaagaaacgaacgatccctccctcgctttaatgtcccacggatatcaaacttgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35017570 |
ggcctccttgtactatgttttggtatcaaactatcaattgaattgaagaaacgaacgatccctccctcgctttaatgtcccacggatatcaaacttgttc |
35017471 |
T |
|
| Q |
101 |
atacaatgccattctgcatgcatatcaaacaaacaagcaaaccataatccaaaagttgtacccaannnnnnngatccaattaatttcaagtttaatatga |
200 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
35017470 |
atacaatgtcattctacatgcatatcaaacaaacaagcaaaccataatccaaaagttgtacccaatttttttgatccaattaatttcaagtttactatga |
35017371 |
T |
|
| Q |
201 |
attcat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
35017370 |
attcat |
35017365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University