View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2396_low_4 (Length: 441)
Name: NF2396_low_4
Description: NF2396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2396_low_4 |
 |  |
|
| [»] scaffold0084 (3 HSPs) |
 |  |  |
|
| [»] scaffold1271 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0084 (Bit Score: 94; Significance: 1e-45; HSPs: 3)
Name: scaffold0084
Description:
Target: scaffold0084; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 141 - 258
Target Start/End: Original strand, 36259 - 36376
Alignment:
| Q |
141 |
cgactcggcttcgacacgtctgtttgcttctgttggtgtatgaatctgattcagtggttccggctatccactgcaactcgttcattacctggtgctgggc |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
36259 |
cgactcggcttcgacgcgtctgtttgcttctgttggtgtatgaatccgattcagtggttccggcgatccgctgcagctcgttcattacctggtgttgggc |
36358 |
T |
 |
| Q |
241 |
tcgacgtcagttgattgt |
258 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36359 |
tcgacgtcagttgattgt |
36376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0084; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 324 - 431
Target Start/End: Original strand, 38607 - 38714
Alignment:
| Q |
324 |
gttttgtgggtacaactttgattggtgttaatgttgttgtgcgaggccggtggttggatttgatgaatgtgttcgatgtgcgattctatgtgcttgtacg |
423 |
Q |
| |
|
|||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
38607 |
gttttgtgaggacgactttaattggtgttaatgttgttgtgcgaggccggtggttggatttgatgaatgtgttggatgtgcgattctatatgtttgtacg |
38706 |
T |
 |
| Q |
424 |
gtcctatg |
431 |
Q |
| |
|
|||||||| |
|
|
| T |
38707 |
gtcctatg |
38714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0084; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 35998 - 36089
Alignment:
| Q |
20 |
cggcgaaccatcgcggctgcgccaccgcgccggagagaaaagggtctcccttttatggatttctaacct-aaatttcacgctcttctcgatt |
110 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||| ||||| ||||||| ||||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
35998 |
cggcgagccatcgcgactgcgccgccgcgccggagacaaaagagtctcccctttatggatttttaacctaaaatttcaccctcttctcgatt |
36089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 79; Significance: 9e-37; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 141 - 255
Target Start/End: Complemental strand, 27510189 - 27510075
Alignment:
| Q |
141 |
cgactcggcttcgacacgtctgtttgcttctgttggtgtatgaatctgattcagtggttccggctatccactgcaactcgttcattacctggtgctgggc |
240 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| | ||||||||||||||||| |||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
27510189 |
cgactcggttccgacacgtccgtttgcttctgttggtgtatgaacccgattcagtggttccggcgatccgctgcagctcgttcgttacctggtgctgggc |
27510090 |
T |
 |
| Q |
241 |
tcgacgtcagttgat |
255 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27510089 |
tcgacgtcagttgat |
27510075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 141 - 255
Target Start/End: Complemental strand, 27518132 - 27518018
Alignment:
| Q |
141 |
cgactcggcttcgacacgtctgtttgcttctgttggtgtatgaatctgattcagtggttccggctatccactgcaactcgttcattacctggtgctgggc |
240 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| | ||||||||||||||||| |||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
27518132 |
cgactcggttccgacacgtccgtttgcttctgttggtgtatgaacccgattcagtggttccggcgatccgctgcagctcgttcgttacctggtgctgggc |
27518033 |
T |
 |
| Q |
241 |
tcgacgtcagttgat |
255 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27518032 |
tcgacgtcagttgat |
27518018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 31 - 106
Target Start/End: Complemental strand, 27510417 - 27510342
Alignment:
| Q |
31 |
cgcggctgcgccaccgcgccggagagaaaagggtctcccttttatggatttctaacctaaatttcacgctcttctc |
106 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
27510417 |
cgcggctgcgccgccgcgctggagacaaaagggtcttttttttttggatttctaacctaaatttcaccctcttctc |
27510342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 31 - 106
Target Start/End: Complemental strand, 27518360 - 27518285
Alignment:
| Q |
31 |
cgcggctgcgccaccgcgccggagagaaaagggtctcccttttatggatttctaacctaaatttcacgctcttctc |
106 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
27518360 |
cgcggctgcgccgccgcgctggagacaaaagggtcttttttttttggatttctaacctaaatttcaccctcttctc |
27518285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1271 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold1271
Description:
Target: scaffold1271; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 318 - 431
Target Start/End: Original strand, 1430 - 1542
Alignment:
| Q |
318 |
tgttgggttttgtgggtacaactttgattggtgttaatgttgttgtgcgaggccggtggttggatttgatgaatgtgttcgatgtgcgattctatgtgct |
417 |
Q |
| |
|
||||||||| | || |||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| | |
|
|
| T |
1430 |
tgttgggttctatgtgtacggctttgatttgtgttaatgctgttgtgcgaggccggtggttggatttgatgaatgtgttgtatgtgcgagtctatgtg-t |
1528 |
T |
 |
| Q |
418 |
tgtacggtcctatg |
431 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
1529 |
tgtacggtgctatg |
1542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 27 - 106
Target Start/End: Complemental strand, 16361174 - 16361093
Alignment:
| Q |
27 |
ccatcgcggctgcgccaccgcgccggagagaaaagggtctcc--cttttatggatttctaacctaaatttcacgctcttctc |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| |||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
16361174 |
ccatcgcggctgcgccgccgcgccggagacaaaagggtctcctttttttttggatttctaccctaaatttcaccctcttctc |
16361093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 5623274 - 5623308
Alignment:
| Q |
20 |
cggcgaaccatcgcggctgcgccaccgcgccggag |
54 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5623274 |
cggcgaaccatcgcggctgcgccgccgcgccggag |
5623308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University