View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2398_high_4 (Length: 244)
Name: NF2398_high_4
Description: NF2398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2398_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 26 - 227
Target Start/End: Complemental strand, 14259929 - 14259725
Alignment:
| Q |
26 |
aacaaccagttatggaagcatttagccctt-gccatgttcaatcaagtaatgtaacataacataaatcttgaaccctcttgccaccggaatgtcgtgtaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
14259929 |
aacaaccagttatggaagcatttagccctttgccatgttcaatcaagtaatgtaacataacataaatcttgaaccctcttaccaccggaatatagtgtaa |
14259830 |
T |
 |
| Q |
125 |
ataagttcactttgcgtaaagatactagatgatataaatagtacttcctccttttgggattttaagtgcttttgttaaatac--atgcattctacattgt |
222 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
14259829 |
ataagttcactttgcataaaaatactagatgatataaatagtacttcctcctttccggattttaagtgcttttgttaaatacatatgcattctacactgt |
14259730 |
T |
 |
| Q |
223 |
tataa |
227 |
Q |
| |
|
||||| |
|
|
| T |
14259729 |
tataa |
14259725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University