View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2398_low_10 (Length: 229)
Name: NF2398_low_10
Description: NF2398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2398_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 40826138 - 40825954
Alignment:
| Q |
13 |
atattattctatcatgtcccatgtactgcaaccagattgacatgctgctgcttttgaactgcttgccacaactttatacagcatcacattatatcaagga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40826138 |
atattattctatcatgtcccatgtactgcaaccagattgacatgctgctgcttttgaactgcttgccacaactttatacagcatcacattataccaagga |
40826039 |
T |
 |
| Q |
113 |
caactcaaaatattttggttacatcacaagcaagagatttactcaattcaatcatagcccagctaaaactcatagacatagctata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40826038 |
caactcaaaatattttggttacatcacaagcaagagatttactcaattcaatcatagcccagct-aaactcatagacatagctata |
40825954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University