View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2398_low_11 (Length: 220)
Name: NF2398_low_11
Description: NF2398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2398_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 40678565 - 40678755
Alignment:
| Q |
13 |
cataggaagagacaattggcaatggagttgttagagaaagagaatttgtattatgaaaatgtgatggagctagaggattatgaagagagtggtggaggag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40678565 |
cataggaagagacaattggcaatggagttgttagagaaagagaatttgtattatgaaaatgtgatggagctagaggattatgaagagagtggtggaggag |
40678664 |
T |
|
| Q |
113 |
agagttctatgggattggaggaggataatgctggtcatggttttggtgctacatttttggcttcaaaatttgctgcaaacactaagaaagg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40678665 |
agagttctatgggattggaggaggataatgctagtcatggttttggtgctacatttttggcttcaaaatttgctgcaaacactaagaaagg |
40678755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 13112079 - 13112029
Alignment:
| Q |
153 |
ttttggtgctacatttttggcttcaaaatttgctgcaaacactaagaaagg |
203 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| || |||||||| |
|
|
| T |
13112079 |
ttttggtgctactgttttggcttcaagatttgctgcaaatacaaagaaagg |
13112029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University