View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2398_low_6 (Length: 247)
Name: NF2398_low_6
Description: NF2398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2398_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 38841220 - 38841449
Alignment:
| Q |
18 |
tctatagctgctgatagatcttcttttattctagtaatcgtttcattactgtttcaagaagttgaaaacctttttacctttctagatcctttcttttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38841220 |
tctatagctgctgatagatcttcttttattctagtaatcgtttcattactgtttcaagaagttgaaaacctttttacctttctagatcttttcttttatt |
38841319 |
T |
|
| Q |
118 |
ctaataggttcataattgttttgaaaattgttctgtagccccattgaatttaccaagcccaaattctgattcattaatgaaaatctaagttatcttactt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841320 |
ctaattggttcataattgttttgaaaattgttctgtagccccgttgaatttaccaagcccaaattctgattcattaatgaaaatctaagttatcttactt |
38841419 |
T |
|
| Q |
218 |
gtagtgaagtctagacatggctataaacaa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38841420 |
gtagtgaagtctagacatggctataaacaa |
38841449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University