View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2399_low_3 (Length: 390)
Name: NF2399_low_3
Description: NF2399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2399_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 166 - 344
Target Start/End: Original strand, 13555484 - 13555662
Alignment:
| Q |
166 |
tgaaaacaaactcctatagccccgttttccctctaatgctaagtgttttgattctttattttgtttcaccttgtctatgtaagaaggagaaagtatttac |
265 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13555484 |
tgaaaacaaactcctctagccccgttttccctctaatgctaagtgttctgattctttgttttgtttcaccttgtctatgtaagaaggagaaagtatttac |
13555583 |
T |
 |
| Q |
266 |
aaatcatacaaatatatacgatgtgatgcaacatggtgctcgtggggatggtaaatctgatgatacacaagtatgttat |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
13555584 |
aaatcatacaaatatatacgatgtgatgcaacatggtgctcgtggagatggtaaatctgatgatacaaatgtatgttat |
13555662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 59 - 154
Target Start/End: Original strand, 13555345 - 13555440
Alignment:
| Q |
59 |
attcaagtttctatttaaacccgaccccatcccagactctcttcacaaaaattaccacagccaaaaatcctcttaactagggttttcagaaagaag |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13555345 |
attcaagtttctatttaaacccgacaccatcacaagctctcttcacaaaaattaccatagctaaaaatcctcttaactagggttttcagaaagaag |
13555440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 343 - 380
Target Start/End: Complemental strand, 13164651 - 13164614
Alignment:
| Q |
343 |
atgtgtttttctattgtccttttaatttaatacctatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13164651 |
atgtgtttttctattgtccttttaatttaatatctatg |
13164614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 350
Target Start/End: Original strand, 32921925 - 32921978
Alignment:
| Q |
298 |
atggtgctcgtggggatggtaaatctgatgatacacaagtatgt-tatgtgttt |
350 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
32921925 |
atggtgctcgtggtgatggcatatctgatgatacacaagtatgtatatgtgttt |
32921978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 339
Target Start/End: Original strand, 2530668 - 2530721
Alignment:
| Q |
286 |
atgtgatgcaacatggtgctcgtggggatggtaaatctgatgatacacaagtat |
339 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||| ||| |||||||| ||||||||| |
|
|
| T |
2530668 |
atgtgatgcaatatggtgcgcgtggtgatggcaaaactgatgattcacaagtat |
2530721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University