View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2438_high_2 (Length: 282)
Name: NF2438_high_2
Description: NF2438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2438_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 21 - 266
Target Start/End: Original strand, 9283582 - 9283827
Alignment:
| Q |
21 |
actgctaatattgtaaatgtaagctgttgtgtcataaccacttaacgcaaaataaatagttgttgcaagtctgcaactatcattttcaactctcatatcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9283582 |
actgctaatattgtaaatgtaagctgttgtgtcataaccacttaacgcaaaataaatagttgttgcaagtctgcaactatcattttcaactctcatatcc |
9283681 |
T |
 |
| Q |
121 |
caaagcagcggttcattcatgtctctcatatgatgatggtttatcattcatatgatgttgtgcctnnnnnnntgagtggttcattcaattcatgtctctc |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9283682 |
caaagcagtggttcattcatgtctctcatatgatgatggtttatcattcatatgatgttgtgcctaaaaaaatgagtggttcattcaattcatgtctctc |
9283781 |
T |
 |
| Q |
221 |
attagatagccctttcaactcttatcttccaaagtagtttattcat |
266 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9283782 |
attaaatagccctttcaactcttatcttccaaagtagtttattcat |
9283827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 73 - 185
Target Start/End: Complemental strand, 35051407 - 35051298
Alignment:
| Q |
73 |
taaatagttgttgcaagtctgcaactatcattttcaactctcatatcccaaagcagcggttcattcatgtctctcatatgatgatggtttatcattcata |
172 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||||||| |||||||| || |||||||||||||| ||| || ||||||||||||| ||||| |
|
|
| T |
35051407 |
taaatagtttctgcaagtctgcaacaatcatcttcaactctcatctcccaaagaagtggttcattcatgtc-ctc--attctgatggtttatcaatcata |
35051311 |
T |
 |
| Q |
173 |
tgatgttgtgcct |
185 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
35051310 |
tggtgttgtgcct |
35051298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 73 - 185
Target Start/End: Original strand, 53324215 - 53324324
Alignment:
| Q |
73 |
taaatagttgttgcaagtctgcaactatcattttcaactctcatatcccaaagcagcggttcattcatgtctctcatatgatgatggtttatcattcata |
172 |
Q |
| |
|
||||||||| || ||||||||||| ||||| |||||||||| | | |||||| || |||||||||||||| ||| || |||||||||||||| ||||| |
|
|
| T |
53324215 |
taaatagtttctgaaagtctgcaacaatcatcttcaactctcgtcttccaaagaagtggttcattcatgtc-ctc--attatgatggtttatcaatcata |
53324311 |
T |
 |
| Q |
173 |
tgatgttgtgcct |
185 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
53324312 |
tggtgttgtgcct |
53324324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University