View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2438_high_7 (Length: 237)
Name: NF2438_high_7
Description: NF2438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2438_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 27644741 - 27644533
Alignment:
| Q |
13 |
gagaagaatgtcgctggagagatcaacaaggccttcgaagccgagttcgtgaagaatctcgacaatgaagaggtgaaggatctttttcttgctgctaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27644741 |
gagaagaatgtcgctggagagatcaacaaggccttcgaagccgagttcgtgaagaatctcgacaatgaagaggtgaaggatctttttcttgctgctaatt |
27644642 |
T |
 |
| Q |
113 |
acttggatatgaagaagcttcttgattttacgagtcaggttattgctgatcgaattgcgaacaagagtgttgagtatgtgaggaagtattttggagttga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27644641 |
acttggatatgaagaagcttcttgattttacgagtcaggttattgctgatcgaattgcgaacaagagtgttgagtatgtgaggaagtattttggagttga |
27644542 |
T |
 |
| Q |
213 |
ggatactga |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
27644541 |
ggatactga |
27644533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 27549239 - 27549029
Alignment:
| Q |
11 |
gtgagaagaatgtcgctggagagatcaacaaggccttcgaagccgagttcgtgaagaatctcgacaatgaagaggtgaaggatctttttcttgctgctaa |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27549239 |
gtgaaaagaatgtcgctggagagatcaacaaggccttcgaagctgagttcgtgaagaatctcgacaatgaagaggtgaaggatctttttcttgctgctaa |
27549140 |
T |
 |
| Q |
111 |
ttacttggatatgaagaagcttcttgattttacgagtcaggttattgctgatcgaattgcgaacaagagtgttgagtatgtgaggaagtattttggagtt |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
27549139 |
ttacttggatacgaagaagcttcttgattttacgagccaggttattgctgatcgaattgagaacaagagtgtggagtatgtgaggaagtattttggcatt |
27549040 |
T |
 |
| Q |
211 |
gaggatactga |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
27549039 |
gaggatactga |
27549029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University