View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2438_low_14 (Length: 224)
Name: NF2438_low_14
Description: NF2438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2438_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 52375355 - 52375164
Alignment:
| Q |
20 |
gaattgacatgatcacgatgcttccactttgtgcaattctctgaagtactttcacaaccatgaaagcacttgtggaatccaatcctgaagttggttcatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52375355 |
gaattgacatgatcacgatgcttccactttgtgcaattctctgaagtactttaacaaccatgaaagcacttgtggaatccaatcctgaagttggttcatc |
52375256 |
T |
|
| Q |
120 |
taggaagagcactattggatcatggattatgtcgattccgattgaaactcgacgcctttctccaccagagactccacggtgaccttcatctc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52375255 |
taggaagagcactattggatcatggattatgtcgattccgattgaaactcgacgcctttctccaccagagactccacggtgaccttcgtctc |
52375164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University