View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2438_low_4 (Length: 390)
Name: NF2438_low_4
Description: NF2438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2438_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 19 - 379
Target Start/End: Complemental strand, 49914936 - 49914576
Alignment:
| Q |
19 |
acattcatagggggttgcagatattgtgtcggcataattgattgctggggtaaacccgcatatgattgattcacaacatgaggtctaagatgaaaattat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914936 |
acattcatagggggttgcagatattgtgtcggcataattgattgctggggtaaacccgcatatgattgattcacaacatgaggtctaagatgaaaattat |
49914837 |
T |
 |
| Q |
119 |
tcattgtttgttgaggaggaaactgattctggttgttgatttgaggttgccattctggtatatcatcatcgtcatcattccagggttgaattgacccccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914836 |
tcattgtttgttgaggaggaaactgattctggttgttgatttgaggttgccattctggtatatcatcatcgtcatcattccagggttgaattgacccccc |
49914737 |
T |
 |
| Q |
219 |
aaatttgtcctgccagtttaccgaggttacagttgttttgttttgcccatatttgtgtacaagttctctcatttgttgtgcaggacgtgatggggtttgg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914736 |
aaatttgtcctgccagtttaccgaggttacagttgttttgttttgcccatatttgtgtacaagttctctcatttgttgtgcaggacgtgatggggtttgg |
49914637 |
T |
 |
| Q |
319 |
acaaccgagtgagatgtgaccatacttggtcccatatgtttttgaaccaagtgtgatgatg |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914636 |
acaaccgagtgagatgtgaccatacttggtcccatatgtttttgaaccaagtgtgatgatg |
49914576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University