View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2439_high_4 (Length: 230)
Name: NF2439_high_4
Description: NF2439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2439_high_4 |
 | |
|
| [»] scaffold0188 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0188 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 13932 - 14138
Alignment:
| Q |
15 |
aagaatagatgattgtttaatagacccctgaaaattattcataatttatgaannnnnnnattataacttaccacccgattgattgagtaatttgagaggt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
13932 |
aagaatagatgattgtttaatagacccctgaaaattattcataatttctgaatttttttattataagttatgacccgattgattgagtaatttgagaggt |
14031 |
T |
|
| Q |
115 |
ttattgagcaaactcaaccaactggttaaaacagttgggctggtccttacaccatccactcggcggcgctaattttggttgagcttgtatattatagaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||| ||||||| |
|
|
| T |
14032 |
ttattgagcaaactcaaccaactggttagaacagttgggctggtccttacaccatccacttggcggcactaattttggttgagcttatatataatagaaa |
14131 |
T |
|
| Q |
215 |
gtgatga |
221 |
Q |
| |
|
||||||| |
|
|
| T |
14132 |
gtgatga |
14138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 91 - 198
Target Start/End: Complemental strand, 13771279 - 13771172
Alignment:
| Q |
91 |
gattgattgagtaatttgagaggtttattgagcaaactcaaccaactggttaaaacagttgggctggtccttacaccatccactcggcggcgctaatttt |
190 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||||||| |||| ||||| ||||||||||||||||||||||||| || || ||||||| ||||| | |
|
|
| T |
13771279 |
gattgattgagcaatctgagaagtttattgagcaaactcagccaattggtttgaacagttgggctggtccttacaccacccgcttggcggcgataattat |
13771180 |
T |
|
| Q |
191 |
ggttgagc |
198 |
Q |
| |
|
|||||||| |
|
|
| T |
13771179 |
ggttgagc |
13771172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 125
Target Start/End: Original strand, 38706060 - 38706088
Alignment:
| Q |
97 |
ttgagtaatttgagaggtttattgagcaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38706060 |
ttgagtaatttgagaggtttattgagcaa |
38706088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University