View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2439_low_1 (Length: 340)
Name: NF2439_low_1
Description: NF2439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2439_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 655208 - 654988
Alignment:
| Q |
13 |
gtatcaaaggtgcaaaatcaagaagaacataagcagatttggggaagatgtaatggactagagtgtccaagagtaagcatatatagaggtcaccctgtag |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
655208 |
gtattaaaggtgcaaaatcaagaagaacataagcagatttggggaagatataatggactagagtgtccaagagtaagcatatatagaggtcaccctgtag |
655109 |
T |
|
| Q |
113 |
tgagaagagaaagaggtttcattgaagctggaaagttaataaggttgcctgattcattagagaagctcaaaactattgcaggtaaaatttcaaattatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
655108 |
tgagaagagaaagaggtttcattgaagctggaaagttaataaggttgcctgattcattagagaagctcaaaactattgcaggtaaaatttcaaattatcc |
655009 |
T |
|
| Q |
213 |
atatgttagtaatgatattgt |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
655008 |
atatgttagtaatgatattgt |
654988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 278 - 333
Target Start/End: Complemental strand, 654993 - 654937
Alignment:
| Q |
278 |
tattgtgtatattgagaaa-taaatgcaagtcttagtatcctgatttatgattttat |
333 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
654993 |
tattgtgtacattgagaaaataaatgaaagtcttagtatcctgatttatgattttat |
654937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University