View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_high_13 (Length: 314)
Name: NF2441_high_13
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 4 - 259
Target Start/End: Complemental strand, 34362818 - 34362559
Alignment:
| Q |
4 |
tcaaggtatacttattgtgttccatttgtttcaccctttcaagcttcagaattcatgtttactcttcttactatgttaatatttatatttgttaactatc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34362818 |
tcaaggtatacttattgtgttccatttgtttcaccctttcaagcttcagaattcatgttcactcttcttactatgttaatatttatatttgttaactatc |
34362719 |
T |
|
| Q |
104 |
ttttaagtttcctctattaaacaccatcaacgtaatttctttgagtcatttcccctactttctttgacacggaagaacaaatggataac--tctaattga |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| | ||||| ||| |
|
|
| T |
34362718 |
ttttaagtttcgtctattaaacaccatcaacgtaatttctttgagtcatttcccctactttctttgacacagaagaacaaatgaatacctgtctaaatga |
34362619 |
T |
|
| Q |
202 |
attttaataaatcaaagaac--atatattgtaactgcacgatcaaagatgtgggtgagga |
259 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
34362618 |
attttaataaatcaaagaacatatatattttaactgcacgatcaaacatgtgggtgagga |
34362559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University