View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_high_15 (Length: 278)
Name: NF2441_high_15
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 58 - 238
Target Start/End: Complemental strand, 43447656 - 43447476
Alignment:
| Q |
58 |
gttaatagcatgagattttcgttgaggtatgaaaccaaacacgtcttaactaagaattgatgatggtagcttcaattaaatagcctctaaggtttgccga |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43447656 |
gttaatagcatgagattttcgttgaggtatgaaaccaaacacgtcttaactaagaattgataatggtagcctcaattaaatagcctctaaggtttgccga |
43447557 |
T |
 |
| Q |
158 |
aaatatttcactcaaactgtagtcagcgtcaccataccacattttccacccaaattaatcaagtagtggaattattatttt |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43447556 |
aaatatttcactcaaactgtagttagcgtcaccataccacattttccacccaaattaatcaagtagtggaattattatttt |
43447476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University