View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_13 (Length: 416)
Name: NF2441_low_13
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 136 - 353
Target Start/End: Original strand, 41848926 - 41849143
Alignment:
| Q |
136 |
ttgattgaatttatcaatctaaaaaataatatgatatgatgaaatagaatgtaacatagtgaaacgtattccgtcctattcatgtattccattatgtcta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41848926 |
ttgattgaatttatcaatctaaaaaataatatgatatgatgaaatagaatgtaacatagtgaaacgtattccgtcttattcatgtattccattatgtcta |
41849025 |
T |
|
| Q |
236 |
cctctttcacnnnnnnnnnntgtattccattatgtccctcaatttttgttctcccaattggtaggaataagatgaaaccccctccttaaaattttctttc |
335 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41849026 |
cctctttcaaaaaaaaaaaatgtattccattatgtccttcaatttttgttctcccaattggtaggaataagatgaaaccccctccttaaaattctctttc |
41849125 |
T |
|
| Q |
336 |
gtgtgtgtcttcatctca |
353 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
41849126 |
gtgtgtgtcttcttctca |
41849143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 93 - 130
Target Start/End: Original strand, 41848845 - 41848882
Alignment:
| Q |
93 |
gtataaattgttttctcttgcactgtgtgtttcgattg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41848845 |
gtataaattgttttctcttgcactgtgtgtttggattg |
41848882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University