View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_17 (Length: 402)
Name: NF2441_low_17
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 6 - 142
Target Start/End: Complemental strand, 38822633 - 38822497
Alignment:
| Q |
6 |
aaaatctatgaaaataattaccacttagcagaataataagacacgaatgtccaacacaaaagttcagattggcacatctggaccgaaaatgacattcatt |
105 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
38822633 |
aaaatctatgaaaacaattaccaattagcagaataataagacacgaatgtccaacacaaaagttcagattggcgcatctgaaccgaaaatgacattcatt |
38822534 |
T |
 |
| Q |
106 |
ttgaaagtcatcagacacagaaaattggatatcaaaa |
142 |
Q |
| |
|
||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
38822533 |
ttgcaagtcatccgacacagaaaattggatgtcaaaa |
38822497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University