View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_28 (Length: 308)
Name: NF2441_low_28
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 86 - 298
Target Start/End: Original strand, 10249304 - 10249513
Alignment:
| Q |
86 |
aagaggaacttaatcatggcttcatatttaaaatgatgttgaaatataatgcactgtgattgttagagttcctgatattttttgggtcgaactcccgata |
185 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10249304 |
aagaggaactaaatcatggcttcatatttaaaatgatgttgaaatataatgcactgtgattgttagagttcctgatattttttgggtcgaactcccgata |
10249403 |
T |
|
| Q |
186 |
ttttgatgattgttcaataagtctctcaaattgctcaacctattattgaatcataacttctgatgacattttttgtaagtaaaacctgatcggatcgtaa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10249404 |
ttttgatgattgttcaataagtctctcaaattgctcaacc---tattgaatcataacttctgatgacattttttgtaagtaaaacctgatcggatcgtaa |
10249500 |
T |
|
| Q |
286 |
cctctgatggtta |
298 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
10249501 |
cttctgatggtta |
10249513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University