View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_29 (Length: 302)
Name: NF2441_low_29
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 83 - 288
Target Start/End: Complemental strand, 55273660 - 55273455
Alignment:
| Q |
83 |
aaattaggaagatttcacccctacctacaaaaaataagaaaatttcaattttacctatttgacttcacacctgcaaaacattatttcctgtgcatcaagt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55273660 |
aaattaggaagatttcacccctacctacaaaaaataagaaaatttcaattttacctatttgacttcacacctgcaaaacattatttcctgtacatcaagt |
55273561 |
T |
 |
| Q |
183 |
tttttgctgttaactcaaatgtcaattaatagttcgtaagcaaactcaaattcaagccctcgacgaaaagaaaaaataatgaacccaataacaactctct |
282 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55273560 |
tttttgcggttaactcaaatgtcaattaatagttcgtaagcaaactcaaattcaagccctcgacgaaaagaaaaaataatgaacccaataacaactctct |
55273461 |
T |
 |
| Q |
283 |
gctgtt |
288 |
Q |
| |
|
| |||| |
|
|
| T |
55273460 |
gttgtt |
55273455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University