View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_33 (Length: 293)
Name: NF2441_low_33
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 100 - 229
Target Start/End: Original strand, 11861074 - 11861203
Alignment:
| Q |
100 |
aatctaaaaagttggtgggaaaaagacatatcggaaaaagatagaccatctttcagttgcatttcaaagctaaatatccaatattgtcctcagttagctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11861074 |
aatctaaaaagttggtgggaaaaagacatacgggaaaatgatagaccatctttcagttgcatttcaaagctaaatatccaatattgtcctcagttagctt |
11861173 |
T |
|
| Q |
200 |
gcatgccgctatatcccggtcttgatgatg |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
11861174 |
ccatgccactatatcccggtcttgatgatg |
11861203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 103 - 229
Target Start/End: Original strand, 11828945 - 11829071
Alignment:
| Q |
103 |
ctaaaaagttggtgggaaaaagacatatcggaaaaagatagaccatctttcagttgcatttcaaagctaaatatccaatattgtcctcagttagcttgca |
202 |
Q |
| |
|
|||||| ||||||||||||| ||||||| ||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
11828945 |
ctaaaaggttggtgggaaaatgacatatgggacaatgatagaccatctttcagttgcatttcaaagctaaatatccaatactgtcctcaattagcttgca |
11829044 |
T |
|
| Q |
203 |
tgccgctatatcccggtcttgatgatg |
229 |
Q |
| |
|
||| ||| ||||||||||||||||||| |
|
|
| T |
11829045 |
tgctgctctatcccggtcttgatgatg |
11829071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 100 - 229
Target Start/End: Complemental strand, 11901438 - 11901309
Alignment:
| Q |
100 |
aatctaaaaagttggtgggaaaaagacatatcggaaaaagatagaccatctttcagttgcatttcaaagctaaatatccaatattgtcctcagttagctt |
199 |
Q |
| |
|
||||| ||||||||||||||||| || || | || || |||||||||| |||||||||||||||||| ||||| ||||||| ||||||| | ||||||| |
|
|
| T |
11901438 |
aatctgaaaagttggtgggaaaatgagatttggggtaatgatagaccatatttcagttgcatttcaaaactaaacatccaatgttgtcctaaattagctt |
11901339 |
T |
|
| Q |
200 |
gcatgccgctatatcccggtcttgatgatg |
229 |
Q |
| |
|
||||||| |||||||| ||||||||||||| |
|
|
| T |
11901338 |
gcatgcctctatatcctggtcttgatgatg |
11901309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 100 - 229
Target Start/End: Original strand, 12039863 - 12039992
Alignment:
| Q |
100 |
aatctaaaaagttggtgggaaaaagacatatcggaaaaagatagaccatctttcagttgcatttcaaagctaaatatccaatattgtcctcagttagctt |
199 |
Q |
| |
|
|||||||| ||||||||||||| || |||| ||| || |||||||||||||||||||||||||| || |||||| |||||||||| || ||||||||| |
|
|
| T |
12039863 |
aatctaaacagttggtgggaaactgagatatgggataatgatagaccatctttcagttgcatttccaaactaaatgtccaatattgccccaagttagctt |
12039962 |
T |
|
| Q |
200 |
gcatgccgctatatcccggtcttgatgatg |
229 |
Q |
| |
|
||||||| |||||||| ||||||||||| |
|
|
| T |
12039963 |
gcatgccactatatcctaatcttgatgatg |
12039992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 69 - 111
Target Start/End: Complemental strand, 37704509 - 37704467
Alignment:
| Q |
69 |
ataagggaatacgtagactcaatttgcaaacaatctaaaaagt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37704509 |
ataagggaatacgtagactcaatttgcaaacaatctaataagt |
37704467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 111
Target Start/End: Complemental strand, 37698691 - 37698649
Alignment:
| Q |
69 |
ataagggaatacgtagactcaatttgcaaacaatctaaaaagt |
111 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
37698691 |
ataagggaatacttagactcaatttgtaaacaatctaataagt |
37698649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 11732812 - 11732876
Alignment:
| Q |
142 |
agaccatctttcagttgcatttcaaagctaaatatccaatattgtcctcagttagcttgcatgcc |
206 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| || ||||||| | ||||| ||| |||| |
|
|
| T |
11732812 |
agaccatctttcccttgcatttcaaaactaaatatccgatgttgtcctaaattagcatgcgtgcc |
11732876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University