View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_37 (Length: 278)
Name: NF2441_low_37
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 13519312 - 13519235
Alignment:
| Q |
40 |
tattcttgatgtggtggttgagtggactactatgattgaccgttcaaaagataagttatcctacaatcttaatcatta |
117 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13519312 |
tattattgatgtggtggacgagtggactactatgattgaccgttcaaaagataagttatcctacagtcttaatcatta |
13519235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University