View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_42 (Length: 255)
Name: NF2441_low_42
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_42 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 65 - 255
Target Start/End: Original strand, 1236057 - 1236247
Alignment:
| Q |
65 |
ttcatttatagatttttggtacctatatcannnnnnnn-attacatgttatgaatactttggtggatgtgaatgtgtcctcatttttatcttcatcaata |
163 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
1236057 |
ttcatttatagattgttggtacctatatcatttttttttattacatgttatgaatactt-ggtggatgtgaacgtgtcttcatttttatcttcatcaata |
1236155 |
T |
 |
| Q |
164 |
gaatggtcttccaacttctatgttcatcttaatcattgaaattagtggaacactaatgacattatcttaattagaccattaatatacctgta |
255 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1236156 |
gaatggtcttccaacttctatgtgcatcttaatcattgaaattagtggaacactaatgacattatcttaattagaccattaatatacctgta |
1236247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 108 - 173
Target Start/End: Original strand, 1233304 - 1233369
Alignment:
| Q |
108 |
atgttatgaatactttggtggatgtgaatgtgtcctcatttttatcttcatcaatagaatggtctt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
1233304 |
atgttatgaatactttggtggatgtgaatgtgtcctcatgtttatcttcttcagtagaatggtctt |
1233369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University