View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_43 (Length: 253)
Name: NF2441_low_43
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 15362085 - 15361862
Alignment:
| Q |
1 |
aatcagttgaaggtgaaagctgtgagagcatgtcaagttcttcaactgaaggcagtgaggaatatgtgaagcaagaagactcatgccaaatgaaaaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||| || ||||||||||||||| ||| || |||||||| |
|
|
| T |
15362085 |
aatcagttgaaggtgaaagctgtgagagcttgtcaagttcttcgtttgaaggcagtgatgaatgtgcgaagcaagaagactcgtgcttaagaaaaaatct |
15361986 |
T |
 |
| Q |
101 |
atctgtaacatataatcattgccttaatgaagtgtcttcaatcaagcaaggttaggtcactttttctattaatattttcaatagtgtgatccatatgtac |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| || |||||||||| ||||||||||| ||||| |||||||||| |||| ||||| ||| |
|
|
| T |
15361985 |
atctgtaacatataatcattgtcttaatgaagtgtcttcaataaaacaaggttaggacactttttctactaata-tttcaatagtatgattcatatatac |
15361887 |
T |
 |
| Q |
201 |
ttgaaagattccagattacaaaact |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15361886 |
ttgaaagattccagattacaaaact |
15361862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University