View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_63 (Length: 204)
Name: NF2441_low_63
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 55 - 132
Target Start/End: Complemental strand, 5495447 - 5495370
Alignment:
| Q |
55 |
gtgtctcacttaatttgattaggcaaccgtttgttgtatatttagataacggttggtttagcggtgacttcaatattc |
132 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
5495447 |
gtgtctcacttaatttggctaggcgaccgtttgttgtatatttaaataatgtttggtttagcggtgacttcaatattc |
5495370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 5495500 - 5495467
Alignment:
| Q |
1 |
tggtgaataaattcttgctctttaacacagaaaa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5495500 |
tggtgaataaattcttgctctttaacacagaaaa |
5495467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University