View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2441_low_8 (Length: 487)
Name: NF2441_low_8
Description: NF2441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2441_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 30 - 462
Target Start/End: Complemental strand, 27189996 - 27189552
Alignment:
| Q |
30 |
cacccaaagcaaccgctcctccaacagcagcatttcgacttccaccgaatttcgagccgagatgaaatcccgcggctactgcgccagcaataacaacggc |
129 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27189996 |
cacccaaagcaacagctcctccaacagcagcatttcgacttccaccgaatttggagccgagatgaaatcccgcggctactgcgccggcaataacaacggc |
27189897 |
T |
 |
| Q |
130 |
ggatgtagcgagacggagtggtggcgatagtttgtcaacgacgttttcgattccggtgagggctttgggcggaggaacggaggaggatgatgaagagcgt |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27189896 |
ggatgtagcgagacggagtggtggtgatagtttgtcgacgacgttttcgattccggtgaggtctttgggcggaggaacggaggaggaggatgatgagcga |
27189797 |
T |
 |
| Q |
230 |
gggagtgagagtttgaaacagtgtcgtttggtggatgaagagagtgggaaagggaagggtaatggaatgagagaagaaggtgtgagagttgacgaaggat |
329 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27189796 |
gggagtgggagtttgaaacggtgtcgtttggtggatgaagagagtgggaaagggaagggtgatggaatgagagaagaaggtgtgagagttgacgaaggat |
27189697 |
T |
 |
| Q |
330 |
tcattgttttggtttgatttgaaatgagaaaa------------gaaaagagaaagttgatgaaagtgtaggagacggttatatatagttagtgtggtcc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27189696 |
tcattgttttggtttgatttgaaatgagaaaagaaatgagaaaagaaaagagaaagttgatgaaagtgtagaagacggttatatatagttagtgtggtcc |
27189597 |
T |
 |
| Q |
418 |
atactccatagggtttaaccctggccgtcacccttttcttcttct |
462 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
27189596 |
atactccatagggtttaaccctagccgtcacccctttcttcttct |
27189552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University