View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2442_high_12 (Length: 322)
Name: NF2442_high_12
Description: NF2442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2442_high_12 |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0005 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 177 - 311
Target Start/End: Original strand, 231093 - 231227
Alignment:
| Q |
177 |
gaggtgcaagtgctctcccttctttgttcttccctcatgaatcccacccctctctttcaacatgcaatttttccatccaacacctgccactccttcaccg |
276 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
231093 |
gaggtgcaggtgctctcccttctttgttcttccctcatgaatcccacccctctctttcaacgtgcaatttttccatccaacacctgccacttcttcacca |
231192 |
T |
 |
| Q |
277 |
ttggttgccactcatacttttttacgtcatccttt |
311 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
231193 |
ttggttgccactcatactcttttacgtcatccttt |
231227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 230916 - 231042
Alignment:
| Q |
1 |
atacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatattnnnnnnn-caacgggcattgaaaccctcggacttcaaatcacattt |
99 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
230916 |
atacttttccatgcatctgtgttttaccaatgcaaggtgcttttatggcatattacaaaaaacaacgggcattgaaaccctcagacttcaaatcacattt |
231015 |
T |
 |
| Q |
100 |
ggcttggattgcttcaattgaagatca |
126 |
Q |
| |
|
|||||||||| ||||||||||| |||| |
|
|
| T |
231016 |
ggcttggattccttcaattgaatatca |
231042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 177 - 311
Target Start/End: Complemental strand, 14586281 - 14586147
Alignment:
| Q |
177 |
gaggtgcaagtgctctcccttctttgttcttccctcatgaatcccacccctctctttcaacatgcaatttttccatccaacacctgccactccttcaccg |
276 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14586281 |
gaggtgcaggtgctctcccttctttgttcttccctcatgaatcccacccctctctttcaacgtgcaatttttccatccaacacctgccacttcttcacca |
14586182 |
T |
 |
| Q |
277 |
ttggttgccactcatacttttttacgtcatccttt |
311 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
14586181 |
ttggttgccactcatactcttttacgtcatccttt |
14586147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 14586458 - 14586332
Alignment:
| Q |
1 |
atacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatattnnnnnnn-caacgggcattgaaaccctcggacttcaaatcacattt |
99 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14586458 |
atacttttccatgcatctgtgttttaccaatgcaaggtgcttttatggcatattacaaaaaacaacgggcattgaaaccctcagacttcaaatcacattt |
14586359 |
T |
 |
| Q |
100 |
ggcttggattgcttcaattgaagatca |
126 |
Q |
| |
|
|||||||||| ||||||||||| |||| |
|
|
| T |
14586358 |
ggcttggattccttcaattgaatatca |
14586332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 3650129 - 3650181
Alignment:
| Q |
1 |
atacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatat |
53 |
Q |
| |
|
||||||| |||||||| |||||| ||| ||||||||||||||| ||||||||| |
|
|
| T |
3650129 |
atactttcccatgcatatgtgttgtaccaatgcaaggtgctttcatggcatat |
3650181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 33053957 - 33053905
Alignment:
| Q |
1 |
atacttttccatgcatctgtgttctacaaatgcaaggtgcttttatggcatat |
53 |
Q |
| |
|
||||||| |||| ||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
33053957 |
atactttcccatacatatgtgttgtaccaatgcaaggtgcttttatggcatat |
33053905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University