View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2442_low_29 (Length: 245)
Name: NF2442_low_29
Description: NF2442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2442_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 201
Target Start/End: Original strand, 47635260 - 47635454
Alignment:
| Q |
7 |
agatatgaattataccctttttatcgaaaccttgctccttcaccatcaccagcgccttcagcagcaccagcgcttgttcctccttcaaccagcactccta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47635260 |
agatatgaattataccctttttatcgaaaccttgctccttcaccatcaccagcgccttcagcagcaccagcgcttgttcctccttcaaccagcactccta |
47635359 |
T |
|
| Q |
107 |
ctttgggaggtaatataatttacgtttgtgataattttgatgaattctgaattttataataactacttgttagggtcacaattatcgacctattt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47635360 |
ctttgggaggtaatataatttacgtttgtgataattttgatgaattctgaattttataataactacttgttagggtcacaattatcgatctattt |
47635454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 196 - 229
Target Start/End: Complemental strand, 47635540 - 47635507
Alignment:
| Q |
196 |
ctatttaatactaattgataaagtcaatttagta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47635540 |
ctatttaatactaattgataaagtcaatttagta |
47635507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 41
Target Start/End: Complemental strand, 9674615 - 9674581
Alignment:
| Q |
7 |
agatatgaattataccctttttatcgaaaccttgc |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9674615 |
agatatgaattataccctttttatcgaaaccttgc |
9674581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University