View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2442_low_30 (Length: 241)
Name: NF2442_low_30
Description: NF2442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2442_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 12565222 - 12564994
Alignment:
| Q |
1 |
attcataaaatgaaatcaggattcaaaaatggatggccctctatcgttcgtcttcgtctcaaagacaaatccgtgacacccttttgcatattctctaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12565222 |
attcataaaatgaaatcaggattcaaaaatggatggccctctatcgttcgtcttcgtctcaaagacaaatccgtgacacccttttgcatattctctaaag |
12565123 |
T |
|
| Q |
101 |
tgaaatcagctggaaacatacctggaaatactcctgtctatctcaatgtgtatgatttgaccacagttaatggctatatgtattgggctggtgtcggtat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12565122 |
tgaaatcagctggaaacatacccggaaatactcctgtctatctcaatgtgtatgatttgaccacagttaatggctatatgtattgggctggtgttggtat |
12565023 |
T |
|
| Q |
201 |
tttccacactggtgttgaaggtcagttca |
229 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |
|
|
| T |
12565022 |
tttccatactggagttgaaggtcagttca |
12564994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University