View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2442_low_33 (Length: 228)
Name: NF2442_low_33
Description: NF2442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2442_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 5878279 - 5878185
Alignment:
| Q |
10 |
aatattattataaatatttttaaacatatacatgattaaaaagtatttgatgaaatatagataaaataaaagtgaacactcatgtaccctttaag |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5878279 |
aatattattataaatatttttaaacatatacatgattaaaaagtatttgatgaaatatagataaaataaaagtgaacactcatgtaccctttaag |
5878185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 5877417 - 5877329
Alignment:
| Q |
126 |
cattaaattacaatgtcttttcgaaaaaggtgaattatatctagatcttcaccaatcatgaaggagataggctatgatgcgtggaaaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
5877417 |
cattaaattacaatgtcttttcgaaaaaggtgaattatatctagatcttcaccaatcatgaaggagataggctatgctgtgtggaaaat |
5877329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University