View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2442_low_39 (Length: 206)
Name: NF2442_low_39
Description: NF2442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2442_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 6 - 130
Target Start/End: Complemental strand, 7584705 - 7584580
Alignment:
| Q |
6 |
ttttattttatttttaaatgagtgttttgttaatgtacaatgagattaatctgctgaattagttaatccttaggttggataccatttttt-aaataactt |
104 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7584705 |
ttttattttatctttaaatgagtcttttgttaatgtacaatgagattgatcttctgaattagttaatccttaggttggataccattttttaaaataactt |
7584606 |
T |
|
| Q |
105 |
caacgttgttgatgtcttgtcaacca |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7584605 |
caacgttgttgatgtcttgtcaacca |
7584580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University