View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2444_low_1 (Length: 468)
Name: NF2444_low_1
Description: NF2444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2444_low_1 |
 |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 183; Significance: 8e-99; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 183 - 421
Target Start/End: Original strand, 14965 - 15203
Alignment:
| Q |
183 |
ccccctcctggttttcttattcgcgcacttccggcttttatacccgcgcttttgatttcgataggatatgttgaccctggaaagtgggtggcaagtatag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14965 |
ccccctcctggttttcttattcgcgcacttccggctgttatacccgcgcttttgatttcgataggatatgttgaccctggaaagtgggtggcaagtatag |
15064 |
T |
 |
| Q |
283 |
aaggtggtgcgaggtttggttttcgtctcatgacttttactcttattttcaattttgccgctatcttctttcagtacttatctgcaagggttggtgtaat |
382 |
Q |
| |
|
||||||||||||||||||||||| ||| || ||||| | || ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
15065 |
aaggtggtgcgaggtttggttttgatctggtggcttttgcgctaattttcaattttgccgctatcttctgtcagtacttatccgcaagggttggtgtaat |
15164 |
T |
 |
| Q |
383 |
cactggacgtggtcttgctcaggtatcatctcattcact |
421 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
15165 |
cactggacgagatcttgctcaggtatcatgtcattcact |
15203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 452
Target Start/End: Original strand, 15341 - 15374
Alignment:
| Q |
419 |
actatttaatgtagcaccttgctattgagaagaa |
452 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
15341 |
actatttaatgtagcaacttgctattgagaagaa |
15374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 115; Significance: 3e-58; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 23 - 145
Target Start/End: Complemental strand, 26458921 - 26458799
Alignment:
| Q |
23 |
tggaacgaaccagcgcgtctccttgaatttcatcccttccacttcgaagctcaatttcattcaactaagatatctcgtttcaatccaccgtcacaatgct |
122 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458921 |
tggaacgaaccagcgcggctccttgaatttcatcccttccacttcgaagctcaatttcattcaactaagatatctcgtttcaatccaccgtcacaatgct |
26458822 |
T |
 |
| Q |
123 |
tcacaacaagtcctttgctaaga |
145 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
26458821 |
tcacaacaagtcctttgttaaga |
26458799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 148 - 260
Target Start/End: Complemental strand, 26458576 - 26458464
Alignment:
| Q |
148 |
agcaattgagttctgaacagaccaagagtaaaatgccccctcctggttttcttattcgcgcacttccggcttttatacccgcgcttttgatttcgatagg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458576 |
agcaattgagttctgaacagaccaagagtaaaatgccccctcctggttttcttattcgcgcacttccggcttttatacccgcgcttttgatttcgatagg |
26458477 |
T |
 |
| Q |
248 |
atatgttgaccct |
260 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26458476 |
atatgttgaccct |
26458464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 337 - 421
Target Start/End: Complemental strand, 26458464 - 26458380
Alignment:
| Q |
337 |
ttgccgctatcttctttcagtacttatctgcaagggttggtgtaatcactggacgtggtcttgctcaggtatcatctcattcact |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26458464 |
ttgccgctatcttctttcagtacttatctgcaagggttggtgtaatcactggacgtcatcttgctcaggtatcatctcattcact |
26458380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 453
Target Start/End: Complemental strand, 26458323 - 26458289
Alignment:
| Q |
419 |
actatttaatgtagcaccttgctattgagaagaat |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26458323 |
actatttaatgtagcaccttgctattgagaagaat |
26458289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 52 - 137
Target Start/End: Complemental strand, 30968489 - 30968405
Alignment:
| Q |
52 |
tcatcccttccacttcgaagctcaatttcattcaactaagatatctcgtttcaatccaccgtcacaatgcttcacaacaagtcctt |
137 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30968489 |
tcatcacttccacttcgaagctcaatttcaa-caactaagatatctcgtttgaattcaccgtcaaaatgcttcacaacaagtcctt |
30968405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University