View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_high_19 (Length: 311)
Name: NF2445_high_19
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 31 - 139
Target Start/End: Original strand, 23996282 - 23996390
Alignment:
| Q |
31 |
gctgttgcacttgatcaagaccctggtaaagactttctagaagtttctgatgcacttcttcatgttattgctaagcttctcaagttcccggtatgataat |
130 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23996282 |
gctgttccacttgatcaagaccctggtaaagactttctagaagtttctgatgcacttcttcatgttattgctaagcttctcaagttcccggtataataat |
23996381 |
T |
|
| Q |
131 |
tcataactg |
139 |
Q |
| |
|
||||||||| |
|
|
| T |
23996382 |
tcataactg |
23996390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University