View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_high_29 (Length: 251)
Name: NF2445_high_29
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 13764934 - 13764696
Alignment:
| Q |
1 |
tgatagtatcccaccagcggcaaaagtatattccagtagtgggtttaaggtgatatacttgtatcttttgaaattttgttttaatgtactnnnnnnntta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
13764934 |
tgatagtatcccaccagcggcaaaagtatattccagtagtgggtttaaggtgatatacttgtatcttttgaaattttgttttaatatactaaaaaaatta |
13764835 |
T |
|
| Q |
101 |
aggaagtggaagttagagaacatttatttgccatggttacaatgattggcaaccacaattactnnnnnnnttaatttatacatacatgaaaattgggaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13764834 |
aggaagtggaagttagagaacatttatttgccatggttataatgattggcaaccacaattactaaaaaaattaatttatacatacatgaaaattgggaat |
13764735 |
T |
|
| Q |
201 |
ttatttgtacaaacaggatgaattactatgggcaacagc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13764734 |
ttatttgtacaaacaggatgaattactatgggcagcagc |
13764696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 239
Target Start/End: Complemental strand, 13774910 - 13774861
Alignment:
| Q |
191 |
aattgggaatttattt-gtacaaacaggatgaattactatgggcaacagc |
239 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
13774910 |
aatttggaatttattttgtacaaacaggatgaattactatgggcagcagc |
13774861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 60
Target Start/End: Complemental strand, 13775298 - 13775241
Alignment:
| Q |
3 |
atagtatcccaccagcggcaaaagtatattccagtagtgggtttaaggtgatatactt |
60 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||| | ||||||||| ||||| |
|
|
| T |
13775298 |
atagtatcccaccagcagcaaaaacatattccagtagtggatataaggtgatctactt |
13775241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University