View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_19 (Length: 358)
Name: NF2445_low_19
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 52 - 295
Target Start/End: Original strand, 5509011 - 5509252
Alignment:
| Q |
52 |
cctttaataccacacattcactcaaatatcatgtcaaaacaatgaatctcttccataaccaatagtaatctttatcattgttttagcttgatcaatctgg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509011 |
cctttaataccacacattcactcaaatatcatgtcaaaacagtgaatctcttccataaccaatagtaatctttatcattgttttagcttgatcaatctgt |
5509110 |
T |
 |
| Q |
152 |
aactaatcccatacatggactaccaactaccccacaatatatcaatccatatattttttagccaaaatgttaaacaataaatctttcttctccactctaa |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509111 |
aactaatcccatacatgaactaccaactaccccacaatatatcaatcc--atattttttagccaaaatgttaaacaataaatctttcttctccactctaa |
5509208 |
T |
 |
| Q |
252 |
acctctaacacaattatgcttacaatgcataatcgtttgtgcgt |
295 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509209 |
acctcaaacacaattatgcttacaatgcataatcgtttgtgcgt |
5509252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University