View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_23 (Length: 354)
Name: NF2445_low_23
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 206 - 343
Target Start/End: Original strand, 45878685 - 45878822
Alignment:
| Q |
206 |
ccaaccttattttgtatatttgcttgtcccgtaagttgtaaaaagttaggtctaaataacatacctctttaaagaattttcatgtcataataatttgagc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45878685 |
ccaaccttattttgtatatttgcttgtcccgtaagttgtaaaaagttaggtctaaataacatacctctttaaagaattttcatgtcataataatttgagc |
45878784 |
T |
|
| Q |
306 |
cgcttgctgatttttcaccccctcccatactcattcat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45878785 |
cgcttgctgatttttcaccccctcccatactcattcat |
45878822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 96 - 206
Target Start/End: Original strand, 45878529 - 45878640
Alignment:
| Q |
96 |
ccatgttgcacttcagctagctttctgttggtcatttccacattgcaccatttaagaaaattgatacttt-gacggtcatttttggacaacttgatagat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
45878529 |
ccatgttgcacttcagctagctttctgttggtcatttccacattgcaccatttaagaaaattgatactttagatggtcatttttggacaacttgatagat |
45878628 |
T |
|
| Q |
195 |
aattctttatgc |
206 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45878629 |
aattctttatgc |
45878640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University