View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_26 (Length: 331)
Name: NF2445_low_26
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 27 - 233
Target Start/End: Complemental strand, 40776463 - 40776256
Alignment:
| Q |
27 |
gattattctgagtttgggtagttattgttcggtgttttggttttgttgatttgttctttattagttaaatgaatcaatgaaagtgattaattagtataac |
126 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40776463 |
gattaatctgagtttcggtagttattgttcggtgttttggttttgttgatttgttctttattagttaaatgaatcaatgaaagtgattaattagtataac |
40776364 |
T |
|
| Q |
127 |
ttttaagattgaacagtaaaataatgcag-agttgatttggaagaaagataaaaattcatttccaaagagtgaaattatttaggccctgattagataaac |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40776363 |
ttttgagattgaacagtaaaataatgcagcagttgatttggaagaaagataaaaattcatttccaaagagtgaaatcatttaggccctgattagataaac |
40776264 |
T |
|
| Q |
226 |
atcttcat |
233 |
Q |
| |
|
|||||||| |
|
|
| T |
40776263 |
atcttcat |
40776256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University