View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_31 (Length: 311)
Name: NF2445_low_31
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 298
Target Start/End: Original strand, 35204453 - 35204721
Alignment:
| Q |
30 |
cgtgaatggtaaaatattaattaaattcgtctctccattgatacttatagaagttttaaagaaatttggttgnnnnnnntcaagatgtggagacgaattt |
129 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35204453 |
cgtgaatggcaaaatattaattaaattcgtctctccattgatacttatagaagttttaaagaaatttgattgaaaaaaatcaagatgtggagacgaattt |
35204552 |
T |
 |
| Q |
130 |
gattaatattttgcaatgtcgacccattttagaatattaacaatgtgatgaatttagttgttacggtcttacaattctatggacaaaattggatatttac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35204553 |
gattaatattttgcaatgtcgacccattttaaaatattaacaatgtgatgaatttagttgttacggtcttacaattctatggacaaaattggatatttac |
35204652 |
T |
 |
| Q |
230 |
tccttgttttccctccacttcatctactgcatctatgatttaatttctcttcgtctttgtttttcattc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
35204653 |
tccttgttttccctccacttcatctactgcatctatgatttaatttctcttcttttttgtttttcattc |
35204721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University