View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_33 (Length: 303)
Name: NF2445_low_33
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 1330358 - 1330162
Alignment:
| Q |
1 |
tcttggaggtgggtgttggatagaactaaagtgtcggcatgtttattctatgaatggtgttggaacccaaaaggatgccttacctgataattggagtttt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330358 |
tcttggagttgggtgttggatagaactaaagtgtcggcatgtttattctatgaatggtgttggaacccaaaaggatgccttacctgataattggagtttt |
1330259 |
T |
|
| Q |
101 |
ttctcgagtttctgtgtatattgacagcgctgttgctggtgtgtgtcgtggaggagttttttgtgagtcggtgggtgctgtcagctcctactgctgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
1330258 |
ttctcgagtttctgtgtatattgacagcgctgttgctggtgtgtgtcgtggaggagatttttgtgggtcggtgggtgctttcagctcctactgctgg |
1330162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 81
Target Start/End: Original strand, 29083197 - 29083229
Alignment:
| Q |
49 |
tatgaatggtgttggaacccaaaaggatgcctt |
81 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
29083197 |
tatgaatggtgttggaacccaaaagaatgcctt |
29083229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 14247570 - 14247373
Alignment:
| Q |
1 |
tcttggaggtgggtgttggatagaactaaagtgtcggcatgtttattctatgaatggtgttggaacccaaaaggatgccttacctgataattggagtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||||| |||||||||||||||||||||||||||| |||||||| ||||| ||||| ||| |
|
|
| T |
14247570 |
tcttggaggtgggtgttggatagaactaaagtgccaacgtgtttgttctatgaatggtgttggaacccaaaagaatgccttatgcgataagtggaggttt |
14247471 |
T |
|
| Q |
101 |
ttc-tcgagtttctgtgtatattgacagcgctgttgctggtgtgtgtcgtggaggagttttttgtgagtcggtgggtgctgtcagctcctactgctgg |
197 |
Q |
| |
|
||| ||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
14247470 |
ttcctcgagtttcagtgaatattgacagcgctgttgctggtgtgtgtcatggaggagttttatgtgggtccgtgggtgctgtcagctcctactgctgg |
14247373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 47 - 196
Target Start/End: Complemental strand, 9850424 - 9850274
Alignment:
| Q |
47 |
tctatgaatggtgttggaacccaaaaggatgccttacctgataattggagttttttc-tcgagtttctgtgtatattgacagcgctgttgctggtgtgtg |
145 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| ||||||||| ||| ||||||| |||||| |||||| | || |
|
|
| T |
9850424 |
tctatgaatggtgttggaacccaaaagaatgccttatgcgataagtggagttttttcctcgagtttcagtgaatattgatagcgctattgctgttacatg |
9850325 |
T |
|
| Q |
146 |
tcgtggaggagttttttgtgagtcggtgggtgctgtcagctcctactgctg |
196 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
9850324 |
ccgtggaggagttttctgtgggttggtgggtgctgtcagctcctactgctg |
9850274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 73
Target Start/End: Complemental strand, 7701561 - 7701528
Alignment:
| Q |
40 |
tgtttattctatgaatggtgttggaacccaaaag |
73 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
7701561 |
tgtttattctatgaatgatgttggaacccaaaag |
7701528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University