View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_4 (Length: 230)
Name: NF2445_low_4
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 24862057 - 24862251
Alignment:
| Q |
21 |
tcaagggttttgtgttttttaacttcagaaagggagtatgtttttgaagaagtgttcatgaatggagtagagatacttttcttgagaattggtttggttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24862057 |
tcaagggttttgtgttttttaacttcagaaagggagtatgtttttgaagaagtgttcatgaatggagtagagatacttttcttgagaattggtttggttt |
24862156 |
T |
|
| Q |
121 |
cttgtgatctttctaagtgtctttcctttgccatccaaccacctgattggttacctggttgtgttggatgttcaaacactatgccaatttctcct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24862157 |
cttgtgatctttctaagtgtctttcctttgccatccaaccacctgattggttacctggttgtgttggatgttcaaacactatgccaatttctcct |
24862251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 33 - 211
Target Start/End: Original strand, 32988030 - 32988208
Alignment:
| Q |
33 |
tgttttttaacttcagaaagggagtatgtttttgaagaagtgttcatgaatggagtagagatacttttcttgagaattggtttggtttcttgtgatcttt |
132 |
Q |
| |
|
||||||| |||||||||| || ||| |||||||| |||| ||||||| || | ||||| ||| ||||||||||||| || | ||| |||| ||| |
|
|
| T |
32988030 |
tgtttttctacttcagaaatggtgtaggtttttgagctagtgatcatgaagggtgaagagagactcttcttgagaattgagttagaatctgatgattttt |
32988129 |
T |
|
| Q |
133 |
ctaagtgtctttcctttgccatccaaccacctgattggttacctggttgtgttggatgttcaaacactatgccaatttc |
211 |
Q |
| |
|
| || |||||||| ||||||||||| |||||||||||||| |||||||| ||||| || ||||||| ||| |||||||| |
|
|
| T |
32988130 |
ccaactgtctttcttttgccatccagccacctgattggttccctggttgagttgggtgctcaaacaatattccaatttc |
32988208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 214
Target Start/End: Original strand, 32958751 - 32958814
Alignment:
| Q |
151 |
ccatccaaccacctgattggttacctggttgtgttggatgttcaaacactatgccaatttctcc |
214 |
Q |
| |
|
||||||||||||| |||||||| || ||||| |||||||| ||||||| ||| ||||| ||||| |
|
|
| T |
32958751 |
ccatccaaccaccagattggtttccaggttgggttggatgctcaaacattatcccaatctctcc |
32958814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University