View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_45 (Length: 260)
Name: NF2445_low_45
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 30 - 146
Target Start/End: Complemental strand, 16822577 - 16822461
Alignment:
| Q |
30 |
taaagaacacatgcattatacataaatttgttcccaattaatttgtaatcaaaataattggtgaatagcttaatttgtatacaacatttagttaggtata |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822577 |
taaagaacacatgcattatacataaatttgtccccaattaatttgtaatcaaaataattggtgaatagcttaatttgtatacaacatttagttaggtata |
16822478 |
T |
 |
| Q |
130 |
caaatactacagctacc |
146 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16822477 |
caaatactacagctacc |
16822461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 144 - 252
Target Start/End: Complemental strand, 16822373 - 16822265
Alignment:
| Q |
144 |
accatgagattattgaaaaaagttgcataagccatcttaatttctttgcatgagtacatgattataattttgtcttccatattattctccctctaatttc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822373 |
accatgagattattgaaaaaagttgcataagccatcttaatttctttgcatgagtacgtgattataattttgtcttccatattattctccctctaatttc |
16822274 |
T |
 |
| Q |
244 |
tttcatctc |
252 |
Q |
| |
|
|||| |||| |
|
|
| T |
16822273 |
tttcttctc |
16822265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University