View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_49 (Length: 247)
Name: NF2445_low_49
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 160
Target Start/End: Original strand, 10562949 - 10562989
Alignment:
| Q |
120 |
gtagggcggattagagatgggggagatgatattgttggaga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
10562949 |
gtagggcggattagagatgggggagatgattttggtggaga |
10562989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 160
Target Start/End: Original strand, 17873438 - 17873475
Alignment:
| Q |
123 |
gggcggattagagatgggggagatgatattgttggaga |
160 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
17873438 |
gggcggattagagatgggggagatgattttgatggaga |
17873475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University