View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2445_low_56 (Length: 209)
Name: NF2445_low_56
Description: NF2445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2445_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 9 - 129
Target Start/End: Original strand, 23332595 - 23332715
Alignment:
| Q |
9 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
109 |
ttcgactcctgatctctctgc |
129 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgc |
23332715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University