View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2446_high_5 (Length: 210)
Name: NF2446_high_5
Description: NF2446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2446_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 40 - 189
Target Start/End: Original strand, 38993406 - 38993555
Alignment:
| Q |
40 |
aatcaataggtttataatattaaaaaaggactaattataatatggctctaacaaataaattataactttgccactnnnnnnnctcaaaaccgtaaaagag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38993406 |
aatcaataggtttataatattaaaaaaggactaattataatatggctctcacaaataaattataactttgccactaaaaaaactcaaaaccgtaaaagag |
38993505 |
T |
 |
| Q |
140 |
tacactgagtaatttcagttaagctcatgtggctcataaatcttagtcaa |
189 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38993506 |
tacactaagtaatttcagttaagctcatgtggctcataaatcttagtcaa |
38993555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University